We narrowed to 6,273 results for: nls
-
Plasmid#171495PurposeT7 promotor drives in vitro transcription of mClover3-tagged bovine Nup98 DN mRNADepositorAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pPD684 VPR-FRB (no NLS)
Plasmid#138851PurposeConstitutive expression of VPR-FRB (no NLS) under the CMV promoter.DepositorInsertVPR-FRB (no NLS)
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD683 VP64-FRB (no NLS)
Plasmid#138850PurposeConstitutive expression of VP64-FRB (no NLS) under the CMV promoter.DepositorInsertVP64-FRB (no NLS)
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD682 VP16-FRB (no NLS)
Plasmid#138849PurposeConstitutive expression of VP16-FRB (no NLS) under the CMV promoter.DepositorInsertVP16-FRB (no NLS)
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD681 FKBP-ZF43 (no NLS)
Plasmid#138848PurposeConstitutive expression of FKBP-ZF43 (no NLS) under the CMV promoter.DepositorInsertFKBP-ZF43 (no NLS)
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD354 VP64-FRB (NLS)
Plasmid#138846PurposeConstitutive expression of VP64-FRB under the CMV promoter.DepositorInsertVP64-FRB
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD353 VP16-FRB (NLS)
Plasmid#138845PurposeConstitutive expression of VP16-FRB under the CMV promoter.DepositorInsertVP16-FRB
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD341 FKBP-ZF43 (NLS)
Plasmid#138844PurposeConstitutive expression of FKBP-ZF43 under the CMV promoter.DepositorInsertFKBP-ZF43
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-QUASM1:GFPNLS-SV40pA
Plasmid#155116PurposeMiddle entry vector containing QUASM1 element upstream of GFP-NLS.DepositorInsertQUASM1:GFPNLS
UseGateway middle entry vectorPromoterQUASM1-E1bAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E1-dTom-nlsdTom
Plasmid#135637PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E1 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E3-dTom-nlsdTom
Plasmid#135638PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E3 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E4-dTom-nlsdTom
Plasmid#135639PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E4 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E10-dTom-nlsdTom
Plasmid#135645PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E10 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLSHF1-P2A-Puro
Plasmid#136901PurposeLentivirus for constitutive expression of FNLSHF1 in mammalian cells (codon optimized)DepositorInsertFNLSHF1
UseLentiviralTagsFLAG-NLS and NLSMutationR661A,Q695A,Q926APromoterEF1sAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Sox2TALE-GCN4
Plasmid#120548PurposeExpress 3xNLS-Sox2 TALE-GCN4 engineered to bind a site in the human SOX2 geneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-NGN2TALE-GCN4
Plasmid#120547PurposeExpress 3xNLS-NGN2 TALE-GCN4 engineered to bind a site in the human NGN2 eneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FRB-TALETS3-3xFLAG-2xNLS
Plasmid#107306PurposeExpresses TALE-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertTALE_VEGFA-TS3
UseCRISPRTags3x Flag, 2xNLS and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hGCN5-NLS
Plasmid#103827PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorExpressionMammalianMutationhGCN5: A566G (E189G), G585T (K195N), G726A (silen…PromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
DsRed-CPI-17-T38A-NLS
Plasmid#100792PurposeMammalian expression of Fluorescent CPI-17 neutral mutation nuclearDepositorInsertprotein phosphatase 1 regulatory inhibitor subunit 14A (PPP1R14A Human)
TagsDsRedExpressionMammalianMutationT38APromoterCMVAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
DsRed-CPI-17-T38E-NLS
Plasmid#100790PurposeMammalian expression of Fluorescent CPI-17 phospho mimetic nuclearDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2 3XFLAG-EGFP-NLS
Plasmid#87778PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIK-HygroDepositorInserteGFP
Tags3xFLAG and NLSAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2 3XFLAG-MKK7-EE-NLS
Plasmid#87777PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIK-HygroDepositorInsertMKK7-EE
Tags3xFLAG and NLSAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2 3XFLAG-MKK4-EE-NLS
Plasmid#87776PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIK-HygroDepositorInsertMKK4 (MAP2K4 Human)
Tags3xFLAG and NLSAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc-mCE NLS
Plasmid#82465PurposeExpresses myc tag and mRNA capping enzyme without Nuclear Localization Sequence (NLS) from C terminusDepositorInsertCapping Enzyme (Rngtt Mouse)
TagsMycExpressionMammalianMutationdeleted amino acids Nuclear Localization SignalPromoterCMVAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBABE-3xFLAG-NLS-TPP1-OB
Plasmid#79060PurposeRetroviral expression of 3xFLAG tagged, nuclear localized wild-type TPP1-OB folding domainDepositorInsertTPP1 (TPP1 Human)
UseRetroviralTags3xFLAG and NLSExpressionMammalianMutationWild-type TPP-OB folding domainPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1L-dC-NLS
Plasmid#51840PurposeFlag-CHES1L mutant lacking the C-terminal, with remaining NLSDepositorInsertCHES1 (FOXN3 Human)
UseRetroviralTagsFlag and NLSMutationcontains CHES1 amino acids 1-205Available SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-CHES1LdFC-NLS
Plasmid#51838PurposeFlag-CHES1L mutant lacking the forkhead binding site and C-terminal domain, with remaining NLSDepositorInsertCHES1 (FOXN3 Human)
UseRetroviralTagsFlag and NLSMutationcontains CHES1 amino acids 1-109Available SinceJuly 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 (-) + FLAG-NLS-MS2-eGFP
Plasmid#86827PurposeExpresses a nuclear localized, FLAG-tagged MS2-GFP fusion protein in mammalian cells, used for purification or localization of tagged RNAsDepositorInsertFLAG-NLS-MS2-eGFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only