We narrowed to 2,518 results for: PLS
-
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBB0323-TEV-His12
Plasmid#137039Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0323 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66700.1
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-D
Plasmid#64516PurposeAS-30D hepatoma hexokinase II 1.0 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseExpressionMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoterAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-lox
Plasmid#190059PurposeExpress the bacterial lactate oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertlox
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-codA
Plasmid#190058PurposeExpress the bacterial choline oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertcodA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBB0238-TEV-His12
Plasmid#137038Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0238 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66635.2
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-F
Plasmid#64518PurposeAS-30D hepatoma hexokinase II 0.075 kbp exon I-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseExpressionMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoter deletedAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-SIRT1
Plasmid#1791PurposeMammalian expression of flag-tagged SIRT1DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcw107-V5
Plasmid#64649Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5ExpressionMutationPromoterPGKAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag-SIRT1 H363Y
Plasmid#1792DepositorInsertSIRT1 (SIRT1 Human)
UseTagsFlagExpressionMammalianMutationH363Y, deacetylase domain mutationPromoterAvailable SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLVX-dL5**-mCER-TRF1
Plasmid#168176PurposeExpresses FAP (dL5**) fused to mCerulean and the telomere binding protein TRF1DepositorInsertTRF1 (TERF1 Human)
UseLentiviralTagsFAP (dL5**) and mCeruleanExpressionMammalianMutationPromoterAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3a WT
Plasmid#8360DepositorAvailable SinceMarch 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-BB0323-ss
Plasmid#137067PurposeE. coli expression clone (T7lac promoter) for mature BB0323 (aa 20-377) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66700.1
UseTagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature BB0323: lacks the BB0323 signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only