We narrowed to 11,973 results for: SOM
-
Plasmid#79880PurposeBeta-actin2 promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to zebrafish Rpl10a ribosomal unit (rpl10a Zebrafish)
TagsAviExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80 HSA (212-526)
Plasmid#29443DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin.PPT.CMV‐GFP‐Eps8 WT
Plasmid#74922PurposeLentiviral plasmid expressing Eps8 fused to GFPDepositorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80C (1224-1556)
Plasmid#29445DepositorAvailable SinceAug. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-S127F
Plasmid#116707PurposeLentiviral expression of WDR12 S127FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1-T69M
Plasmid#116675PurposeLentiviral expression of ROR1 T69MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154G/H250Y
Plasmid#108490Purposeexpression of vsv-AuroraB Analog sensitive (L154G/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154G/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II no force control (FL-based)
Plasmid#118724PurposeThe no force control for the FL-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor NTRK1-P2A-tdTomato
Plasmid#246653PurposeDonor plasmid for Crispr/Cas9 gene editing of the human NTRK1 locusDepositorInsertP2A-tdTomato flanked by NTRK1 homology regions (NTRK1 Human, Synthetic)
UseCRISPRExpressionMammalianMutationtdTomato was altered to contain a silent SAL1 res…Available SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-TOP3B (WT)-3xFLAG
Plasmid#249681PurposeExpresses human TOP3B (wildtype) with a C-terminal 3xFLAG tagged in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET_Y34X
Plasmid#246084PurposeStable expression of LYSET Y34X (isoform 2; Y72X in isoform 1)DepositorAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D1-86-SFB
Plasmid#247913PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D1-86DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 1-86Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-FL-SFB
Plasmid#247912PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-SFB-ZNF451
Plasmid#247909PurposeMammalian expression construct for N-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged ZNF451DepositorInsertZNF451 (ZNF451 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 CHIP delU-box-Myc
Plasmid#246738PurposeMammalian expression of human CHIP with U-box domain deleted, and a myc-tag on its C-terminusDepositorInsertCHIP (Carboxy terminus of Hsc70-interacting protein) (STUB1 Human)
TagsMycExpressionMammalianMutationdeletion of U-box domainPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET
Plasmid#246082PurposeStable expression of LYSET (isoform 2)DepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET_R7W
Plasmid#246083PurposeStable expression of LYSET R7W (isoform 2; R45W in isoform 1)DepositorAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16Q-Halo-FRT
Plasmid#247458PurposeExpresses wild-type H4K16Q-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only