We narrowed to 10,491 results for: fus
-
Plasmid#50480Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
TagsmCherry fusion in M3-M4 loop (after residue A405)ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFB-Flag-MyoD-E12
Plasmid#25990DepositorAvailable SinceSept. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1-fsr1
Plasmid#179868PurposeConstitutive expression vector for Saccharomyces cerevisiae comprising the polyketide synthase fsr1 from Fusarium vanettenii and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertsPPT1
fsr1
ExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1 and Yarrowia lipolytica …Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdICAM1-ST3-His
Plasmid#210666PurposeExpression of the extracellular domain of human ICAM1 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human ICAM-1 fused to Spytag003 and Histag (ICAM1 Human, Synthetic)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
BC-Sig-GPRC
Plasmid#44201DepositorInserthuman GPR56 C-terminal fragment with signal peptide (ADGRG1 Human)
UseRetroviralTagsnoneExpressionMammalianMutationThe C-terminal fragment of GPR56, starting at am…PromoterLTRAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUB6-HuMGF
Plasmid#190782PurposeExpresses membrane-bound form of human SCF in mammalian cellsDepositorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLC-HA active Nedd8-P2A-Hygro
Plasmid#124307PurposeLentiviral vector for expression of HA tagged active or C-terminal cleaved Nedd8-P2A-Hygro casette from a CMV promoterDepositorInsertNedd8 (NEDD8 Human)
UseLentiviralTagsHAExpressionMammalianMutationFive C-terminal amino acids missing compared to w…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-EGFP-Cx43ML-N1
Plasmid#49860PurposeEncodes human connexin 43 with all internal methionines mutated to leucine and a C_terminal EGFP fusion tagDepositorInsertConnexin 43 (GJA1 Human)
TagsEGFPExpressionMammalianMutationAll internal Methionines mutated to Leucine. No s…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
JG676: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X2)
Plasmid#104569PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to two DmrA domainsDepositorInsertdLbCpf1(D832A)-DmrA(x2)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
JG674: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X1)
Plasmid#104568PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to one DmrA domainDepositorInsertdLbCpf1(D832A)-DmrA(x1)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdLbCas12a(D832A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(LbBE1.1) (RTW1295)
Plasmid#114085PurposeCAG promoter expression plasmid for human codon optimized LbBE1.1DepositorInserthuman codon optimized DNase-inactive (D832A) LbCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (LbBE1.1)
TagsSV40 NLSExpressionMammalianMutationD832AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mM₃O-IP
Plasmid#46644DepositorInsertmM₃O (Pou5f1 Mouse)
UseRetroviralTagsIRES Puro and mouse MyoD (aa 1-62)ExpressionMammalianMutationcontains a fragment of mouse MyoD (aa1-62) fused …Available SinceJuly 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMMP-NGFR:LMP1-IRES-mRFP
Plasmid#36974DepositorUseRetroviralExpressionMammalianMutationNGFR:LMP1 chimeric receptor consists of aa 1–276 …PromoterCMVAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBCG10
Plasmid#232323PurposeMake mazF a counterselection marker to replace sacB in pZP06CDepositorInsertmazF-tetR
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-Her2-dL5-Her2
Plasmid#85624PurposeBacterial expression vector for Z342-dL5(E52D)-Z342 affibody fusion protein (AFA) with N-terminal His10, GST and HRV3C cleavage site (MBIC5, dL5**, FAP, AffiFAP)DepositorInsert10XHis-GST-HRV-Her2-dL5-Her2 (EGFR Human, Schistosoma japonicum, Synthetic)
Tags10XHis-GST-HRV and The Her2 Affibody and dL5 FAP …ExpressionBacterialMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEE062
Plasmid#176819PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert701
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only