We narrowed to 10,222 results for: Ada;
-
Plasmid#180425Purposemammalian expression of human SEPT7 Gmut2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCW-eGFP-SHLD2
Plasmid#114119PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-SHLD2DepositorInsertSHLD2 (SHLD2 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-CMVtight-HNF1A-FLAG-Hygro
Plasmid#183232PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1ADepositorAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW-ND-Cdt1Δ499-546-HA-Puro
Plasmid#193768PurposeDoxycyline-inducible (TetOn) human Cdt1 (SDV40 NLS , C-terminal HA ) w/ mutations stopping S phase degradation and in MCM binding domain (Δ499-546), expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertND-Cdt1Δ499-546 (CDT1 Human)
UseLentiviralTagsHAMutationamino acids 1-19 deleted, ΔCy mutation (aa68-70 t…PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 R313PRR
Plasmid#184629PurposeMammalian expression vector with N-terminal Flag for KBTBD4 R313PRR expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 R313PRR (KBTBD4 Human)
ExpressionMammalianMutationR313PRRPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-SHLD3
Plasmid#114126PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-tagged SHLD3DepositorInsertSHLD3 (SHLD3 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
KHC068 BRD2-KI-GFP-2A-L387A
Plasmid#231713PurposeCRISPR mediated KI of BromoTag at N-terminus of BRD2-GFP-P2A-BromoTag, works well with KHC064 and KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-AMBRA1-3xFLAG
Plasmid#174159PurposePiggyBac vector to stably express 3xFLAG-tagged AMBRA1DepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 C4762S (ShB-R)
Plasmid#55614PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged C4762S (catalytically inactive) HERC2 in Flp-In T-Rex cellsDepositorInsert3xFLAG tagged HERC2 (C4762S) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationC4762 mutated to serine to render HERC2 catalytic…Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-SHLD3
Plasmid#114125PurposeExpresses N-terminally tagged eGFP-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagseGFPExpressionMammalianPromoterCMV/TetO2Available SinceAug. 16, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
8024 GFP_Kras_G12C_2A_puro
Plasmid#64373PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2A oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
8027_GFP-KrasG12C_2B_puro
Plasmid#64372PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-FLAG-SHLD3
Plasmid#114123PurposeExpresses N-terminally tagged FLAG-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsFLAGExpressionMammalianPromoterCMV/TetO2Available SinceAug. 16, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/TO-FLAG-SHLD1
Plasmid#114115PurposeExpresses N-terminally tagged FLAG-SHLD1 in mammalian cellsDepositorInsertSHLD1 (SHLD1 Human)
UseGenomic integration, tetracycline inducibleTagsFLAGExpressionMammalianPromoterCMV/TetO2Available SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpp1-is3
Plasmid#58247PurposeExpression vector producing isoform 3 derived mouse osteopontin (EGFP tagged)DepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only