We narrowed to 9,891 results for: tre promoter
-
Plasmid#183464PurposeTo produce AAV with the P3 promoter to express Alb-mCarmine fusion proteinDepositorAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pET28a-CTLA4-FLN-ELP-His-ybbr
Plasmid#168038PurposeExpresses CTLA-4 with FLN fingerprint domain, ELP linker, 6x-His tag and ybbr tag at the C terminusDepositorInsertCytotoxic T-lymphocyte associated protein 4 (CTLA4 Human)
Tags3x ELP linker, 6x Histag, ddFLN4 (C18S), and ybbr…ExpressionBacterialPromoterT7 promoterAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
scAAV-TTR-mFgf15
Plasmid#190594PurposeAAV construct containing Fgf15 cds under control of TTR promoterDepositorAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 ATP2B1
Plasmid#60788PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and wild-type miR-155 sitesDepositorInsertATP2B1 3'UTR and wild-type miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMCh2008_pLenti_Syn_mChe-cdc42E7-E63'UTR
Plasmid#118622Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR under pSyn promoter for primary neuronsDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged ttgcttt to cggtaag (496 - 502 nt in 3…Promotersynapsin I (rat)Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CaMKIIα-optoFGFR1-HA
Plasmid#250236PurposeAAV expressing light-activatable FGFR1 (optoFGFR1-HA) under the CaMKIIα promoter for excitatory-neuron-specific activationDepositorAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA
Plasmid#227683PurposeTo over express Phospho-dead Ezrin under gfaABC1D promoter in astrocytesDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmClover3-hsLem2
Plasmid#179524PurposeExpress OsTIR1 and mClover3-mAID-hsLem2 in mammalian cells under the control of EF1a promoterDepositorAvailable SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-eGFP-Puro
Plasmid#79823PurposeExpresses human NEUROGENIN2 (hNGN2), eGFP and puromycin resistance gene under control of TetON promoter. This 3rd generation lentiviral vector is used to generate NGN2-iNs from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Neo
Plasmid#99378PurposeExpresses human NEUROGENIN2 (hNGN2) and neomycin resistance gene under control of TetON promoter. 3rd generation lentiviral backbone.DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC293 - pAAV EF1a V5-synuclein (WT)
Plasmid#60057PurposeAn AAV packaging vector that expresses wildtype alpha-synuclein under control of the EF1a promoter.DepositorAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK FKBP12(F36V)-OGT (Neo)
Plasmid#154294PurposeLentiviral vector encoding FKBP12(F36V)-2xHA-OGT (Neomycin resistant) off PGK promoterDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianPromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hSNCA
Plasmid#170445PurposeLentiviral vector expressing human SNCA, under control of EF1alpha promoter.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only