We narrowed to 14,065 results for: crispr grnas
-
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTargetF-FRT
Plasmid#113637PurposeDerivative of pTargetF with gRNA targeting FRT siteDepositorInsertsgRNA-FRT
UseCRISPRPromoterpJ23119Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf
Plasmid#65825Purposezwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertzwf guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA
Plasmid#65818PurposeudhA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertudhA guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2
Plasmid#65817PurposegltA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA2 guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_047
Plasmid#107145Purposemeasures Cas9 activityDepositorInsertGFP + sgRNA for GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherry
Plasmid#84250PurposeExpresses optimized Sa sgTRE3G gRNA with a mCherry fluorescent markerDepositorInsertSa sgTRE3G
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1870-1 pHR: U6-SpsgTRE3G CMV-mCherry
Plasmid#84248PurposeExpresses Sp sgTRE3G gRNA with a mCherry fluorescent markerDepositorInsertSp sgTRE3G
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherry
Plasmid#84249PurposeExpresses Sp sgSV40 gRNA with a mCherry fluorescent markerDepositorInsertSp sgSV40
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only