We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#99481Purpose3XFlag::tagBFP::MycDepositorInsert3XFlag::tagBFP::Myc
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSF511
Plasmid#222719PurposeCRISPR/Cas9 plasmid with gRNA1 for site gsdA, Cas9DepositorArticleInsertgRNA1(gsdA)
UseCRISPR; A. nigerExpressionBacterialPromoterpmbfAAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR 6colors
Plasmid#229974PurposebigMamAct assembled plasmid for 6colors cellular labellingDepositorInsertmito-mCherry, EYFP-tubulin, H2B iRFP720, GTS-mTagBFP, mTFP1-actin
UseCRISPRExpressionMammalianMutationSee Depositor CommentsAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB U6
Plasmid#229956PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty U6-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB EF1alpha
Plasmid#229954PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty EF1alpha-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB TRE
Plasmid#229955PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty Tet-responsive element (TRE)-driven cassette; users should clone gene of interest into shuttle plasmid prior to Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_REC8_cterm
Plasmid#222522PurposeCas9/sgRNA plasmid for targeting REC8DepositorInsertCas9, REC8 sgRNA (REC8 Human, Synthetic)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWT007h
Plasmid#107892PurposeW1.0.1c plasmid. Contains PTetO-SD8-Cas9, PLac-sgRNA(con.) and is part of CAMERA 1.0.1cDepositorInsertPTetO-SD8-Cas9, PLac-sgRNA(con.)
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP574-1
Plasmid#99477Purpose3XFlag::Topaz::MycDepositorInsert3XFlag::Topaz::Myc
ExpressionBacterialAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP996-1
Plasmid#99499Purpose3XFlag::meGFP::linker::TEVDepositorInsert3XFlag::meGFP::linker::TEV
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP835-1
Plasmid#99495PurposeTEV::meGFP::3XFlagDepositorInsertTEV::meGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMLS292
Plasmid#73725PurposeSapTrap 2xNLS-mCherry + Cbr-unc-119 donor plasmidDepositorInsert2xNLS-mCherry + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-Cetn1
Plasmid#50717PurposeCetn1 genomic region was placed in pCAG-EGxxFP. Positive control for DSB mediated EGFP reconstitution.DepositorAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A11.2 gRNA
Plasmid#90550Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E9.3 gRNA
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E10.3 gRNA
Plasmid#90685Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
DLGAP5 D2.4 gRNA
Plasmid#90655Purpose3rd generation lentiviral gRNA plasmid targeting human DLGAP5DepositorInsertDLGAP5 (Guide Designation D2.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DYNLL2 A10.5 gRNA
Plasmid#90663Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLL2DepositorInsertDYNLL2 (Guide Designation A10.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F12.4 gRNA
Plasmid#90939Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
CLTC G9.4 gRNA
Plasmid#90634Purpose3rd generation lentiviral gRNA plasmid targeting human CLTCDepositorInsertCLTC (Guide Designation G9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A12.2 gRNA
Plasmid#90551Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A12.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
NAE1 G8.3 gRNA
Plasmid#90777Purpose3rd generation lentiviral gRNA plasmid targeting human NAE1DepositorInsertNAE1 (Guide Designation G8.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A5.5 gRNA
Plasmid#90568Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A5.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E2.3 gRNA
Plasmid#90881Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
RRM2 E4.3 gRNA
Plasmid#90883Purpose3rd generation lentiviral gRNA plasmid targeting human RRM2DepositorInsertRRM2 (Guide Designation E4.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
RRM2 E3.3 gRNA
Plasmid#90882Purpose3rd generation lentiviral gRNA plasmid targeting human RRM2DepositorInsertRRM2 (Guide Designation E3.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
KIF20A D5.2 gRNA
Plasmid#90718Purpose3rd generation lentiviral gRNA plasmid targeting human KIF20ADepositorInsertKIF20A (Guide Designation D5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A9.2 gRNA
Plasmid#90548Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A9.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
FEN1 C10.3 gRNA
Plasmid#90689Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL B4.4 gRNA
Plasmid#90755Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 C3.2 gRNA
Plasmid#90628Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorInsertCHEK2 (Guide Designation C3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Rad51AP1 B12.3 gRNA
Plasmid#90869Purpose3rd generation lentiviral gRNA plasmid targeting human Rad51AP1DepositorInsertRad51AP1 (Guide Designation B12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G4.4 gRNA
Plasmid#90899Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G4.4)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G3.4 gRNA
Plasmid#90898Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
FEN1 C9.3 gRNA
Plasmid#90688Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only