We narrowed to 16,142 results for: GRN
-
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-trmI
Plasmid#89955PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.DepositorInserttrmI gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-for
Plasmid#81216PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pfkB
Plasmid#102284PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting pfkB.DepositorInsertpfkB gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-xylA
Plasmid#89964PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting xylA.DepositorInsertxylA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_3
Plasmid#73527PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA_zebrafish_mmp21
Plasmid#72890Purposeplasmid to generate guideRNA against mmp21 gene in zebrafishDepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNAY-4
Plasmid#248556PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNAY-4
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA22-3
Plasmid#248550PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA22-3
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA14-3
Plasmid#248542PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA14-3
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA13-3
Plasmid#248540PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA13-3
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA10-1
Plasmid#248535PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA10-1
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA4-3
Plasmid#248527PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA4-3
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only