We narrowed to 8,980 results for: sgRNA
-
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_TRNAU1AP (pAVA3291)
Plasmid#254883PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting TRNAU1APDepositorInsertTwo sgRNAs targeting TRNAU1AP
UseCRISPR and LentiviralPromoterU6/7SKAvailable SinceJune 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_PRPF39 (pAVA3245)
Plasmid#254885PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting PRPF39DepositorInsertTwo sgRNAs targeting PRPF39
UseCRISPR and LentiviralPromoterU6/7SKAvailable SinceJune 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_WDR61 (pAVA3321)
Plasmid#254886PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting WDR61DepositorInsertSinlge sgRNA targeting WDR61
UseCRISPR and LentiviralPromoterU6Available SinceJune 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-NEO-T7-sgRNA
Plasmid#245118PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-BSD-T7-sgRNA
Plasmid#245119PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-T7-sgRNA
Plasmid#245108PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-PtALSgRNA
Plasmid#245881PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequenceDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2
Plasmid#236733PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ERDepositorInsertNegative CTRL
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_ER-dAPEX-BFP2
Plasmid#236734PurposeDual sgRNA targeting TIMM23 expressing dAPEX-BFP targeting to ERDepositorInsertTIMM23 (TIMM23 Human)
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-sgRNA
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only