We narrowed to 6,946 results for: crispr cas9 plasmids

#113034

AAV vector for expression of SpyCas9 in mammalian cells

Dominik Niopek

Bubeck et al Nat Methods. 2018 Oct 30. pii: 10.1038/s

Oct. 30, 2018

Academic Institutions and Nonprofits only

#121936

CRISPR-Sirius plasmid

Thoru Pederson

Ma et al Nat Methods. 2018 Nov;15(11):928-931. do

Feb. 12, 2019

Academic Institutions and Nonprofits only

#108298

pX459 V2.0 (Plasmid #62988) with the K848A, K855A, K1003A, and R1060A mutations

Yuichiro Miyaoka

Kato-Inui et al Nucleic Acids Res. 2018 May 18;46(9):467

May 18, 2018

Academic Institutions and Nonprofits only

#108297

pX459 V2.0 (Plasmid #62988) with the K810A, K848A, K1003A, and R1060A mutations

Yuichiro Miyaoka

Kato-Inui et al Nucleic Acids Res. 2018 May 18;46(9):467

May 18, 2018

Academic Institutions and Nonprofits only

#162161

Expresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)

Charles Rice

Rozen-Gagnon et al Sci Rep. 2021 Jan 12;11(1):736. doi: 10.

Jan. 15, 2021

Academic Institutions and Nonprofits only

#162163

Expresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectable

Charles Rice

Rozen-Gagnon et al Sci Rep. 2021 Jan 12;11(1):736. doi: 10.

Jan. 15, 2021

Academic Institutions and Nonprofits only

#118154

Catalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.

Jorge Ferrer

March 27, 2019

Academic Institutions and Nonprofits only

#113657

dCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.

Jeffrey Barrick

Geng et al ACS Synth Biol. 2019 Mar 15;8(3):521-531

Jan. 18, 2019

Academic Institutions and Nonprofits only

#138944

Fungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markers

Arnold Driessen

Mozsik et al Sci Rep. 2021 Jan 13;11(1):1118. doi: 10

Jan. 19, 2021

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only