We narrowed to 2,180 results for: PAM
-
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCB591
Plasmid#141096PurposeE. coli-Lactobacilli shuttle vector for recombineering template cloningDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
p330 VQR
Plasmid#101730PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458 EQR
Plasmid#101731PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationEQR (D1135E, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-SPNM-B
Plasmid#48661PurposeBacterial SP and NM repression YFP reporter: protospacer BDepositorInsertSP/NM prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
px330 VRER
Plasmid#101729PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
p458 VRER
Plasmid#101728PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330 EQR
Plasmid#101733PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationEQR (D1135E, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGY40
Plasmid#249718PurposepGY40 is a CRISPR cytosine base editing vector with nCas9 and sgRNA cassette, enabling targeted C-to-T conversions at NGG PAM sites in filamentous fungi.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY49
Plasmid#249719PurposepGY49 is a CRISPR adenine base editing vector with nCas9 and sgRNA cassette, enabling targeted A-to-G conversions at NGG PAM sites in filamentous fungi.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKO023
Plasmid#242923PurposeReporter J1-J3(122)-BBa_J23117 with Sth1 PAMDepositorInsertJ1-J3(122)
UseCRISPR and Synthetic BiologyPromoterBba_J23117Available SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL1_3
Plasmid#199035PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpAM?1 ORI plus NGS barcode 3
UseSynthetic BiologyAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only