We narrowed to 10,290 results for: ADA
-
Plasmid#173992PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motifs #1, #2, #3 and #4 mutated
UseLuciferaseMutation4X Coordinator motif mutations #1-2-3-4PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#6
Plasmid#173990PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #6 mutated
UseLuciferaseMutationCoordinator motif mutation #6PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#4
Plasmid#173988PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #4 mutated
UseLuciferaseMutationCoordinator motif mutation #4PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-frog_min2
Plasmid#173970PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and frog minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-coelacanth_min2
Plasmid#173971PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and coelacanth minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-chicken_min2
Plasmid#173968PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and chicken minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#7
Plasmid#173991PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #7 mutated
UseLuciferaseMutationCoordinator motif mutation #7PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-platypus_min2
Plasmid#173967PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and platypus minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_3XCoordinatorMutant#5-6-7
Plasmid#173993PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motifs #5, #6 and #7 mutated
UseLuciferaseMutation3X Coordinator motif mutation #5-6-7PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2_3XCoordinatorMutant
Plasmid#173964PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with 3 mutated Coordinator motifs
UseLuciferaseMutation3 mutated Coordinator motifsPromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-mouse_min2
Plasmid#173965PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and mouse minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-EC1.45-human_min1-lizard_min2
Plasmid#173969PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertHuman minimal enhancer region 1 (min1) and lizard minimal enhancer region 2 (min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmTHC_PGKneoLox2DTA.2
Plasmid#112624PurposeH2BmTeal_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsmTeal (mTFP1)PromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_26
Plasmid#60306PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_34
Plasmid#60313PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_12
Plasmid#60319PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS C18orf26)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_14
Plasmid#60321PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS CCRN4L)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_7
Plasmid#60256PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSLC30A8 enhancer (SLC30A8 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_15
Plasmid#60262PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertFAM148A enhancer (C2CD4A Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only