We narrowed to 10,284 results for: EPO
-
Plasmid#74129PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 40 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash4
Plasmid#74132PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 225 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash3
Plasmid#74131PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 171 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEND-164_Cacnes_pFAST
Plasmid#225616PurposeReplicative vector for anaerobic fluorescent reporter protein FAST tag strong constitutive recombinant expression in C. acnes. pBRESP36A with P(BBa_J23119)+RBS_1+pFAST.DepositorInsertpFAST
UseSynthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-VEGF(Nb35) PAGER(TF)
Plasmid#230000PurposeExpresses anti-VEGF PAGER(TF) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-Nb35-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-5p
Plasmid#103156PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TPC2-D276K-G-GECO1.2
Plasmid#207142PurposeFusion of Ca2+ reporter and pore-dead lysosomal Ca2+-permeable channelDepositorInsertTPC2N2 (TPCN2 Human)
TagsG-GECO1.2ExpressionMammalianMutationChanged Aspartate 276 to LysinePromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-PDAP1-3'UTR-Mut4x
Plasmid#182256PurposeHuman PDAP1 3` UTR region mutated in 4x binding site for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of PDAP1 gene mutated in 4 binding sites for mir-150
UseLuciferaseExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mNeonGreen-CI
Plasmid#196850PurposeExpression of green fluorescent reporter mNeonGreen driven by the strong Beta-actin promoterDepositorInsertmNeonGreen
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
EK0007-PB-4XnrUAS-H2B-BFP
Plasmid#236121PurposeFuorescent reporter encoding H2B-tagBFP fusion under control of E1b minimal promoter with four Gal4-binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsmTagBFP2ExpressionMammalianPromoterE1b minimal promoter with four Gal4-binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-3xnls-Tq-Ca-FLITS
Plasmid#145030PurposepiggyBac vector for expressing a Turquoise calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-Tq-Ca-FLITS
Tags3xnls-Tq-Ca-FLITSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2
Plasmid#66948PurposeMammalian expression of rat ErbB2 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutation(See depositor comment below on mutations A24T an…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-DIO-TRPV1-P2A-mCherry
Plasmid#200831PurposeIn the presence of Cre, drives neuron-specific expression of TRPV1 with fluorescence reporter mCherryDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT5-d2EGFP-mCherry
Plasmid#201454PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA407-Neo-COVGT5-mCherry
Plasmid#201455PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_mCherry
UseLentiviral and Synthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACE2(-252)-luc
Plasmid#31111PurposeLuciferase reporter construct for human ACE2 promoterDepositorInsertACE2 promoter (ACE2 Human)
UseLuciferaseExpressionMammalianMutationpromoter region -252 to +103Available SinceOct. 14, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits