We narrowed to 23,621 results for: promoter
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDT2:GUS
Plasmid#108444PurposeArabidopsis transformation, expresses HDT2 promoter/GUS fusion to study expression pattern in rootsDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E
Plasmid#91999PurposeExpresses FLAG-HA-AGO2 (S824E-S828E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S831E
Plasmid#92000PurposeExpresses FLAG-HA-AGO2 (S824E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S828E-S831E
Plasmid#92001PurposeExpresses FLAG-HA-AGO2 (S828E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E-S831E
Plasmid#92002PurposeExpresses FLAG-HA-AGO2 (S824E-S828E-S831E)DepositorInsertAGO2 (AGO2 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationS824E, S828E, S831EAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824A-T830A
Plasmid#92003PurposeExpresses FLAG-HA-AGO2 (S824A-T830A)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-FLL[157-159]AAA
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-N[80]A
Plasmid#96992PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/mutE2F(-69)-like
Plasmid#66743Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationGCG (-69,-68,-67) to ATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-PIAL2M-sim1
Plasmid#67908PurposeInducible expression of a mutant of PIAL2M where the SIM interacting motif 1 (VFDL 425-428) was substituted with alanines.DepositorInsertPIAL2 (AT5G41580 Mustard Weed)
TagsMBPExpressionBacterialMutationE281-A496; VEDL 425-428 AAAPromoterP-lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site1)
Plasmid#62580PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The upstream miR-21 (site 1) binding site was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 1 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site 2)
Plasmid#62581PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The downstream miR-21 binding site (site 2) was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 2 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344B
Plasmid#34602DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206A
Plasmid#34599DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only