We narrowed to 11,081 results for: AGA
-
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE-9-RTXMCR-TLY-X2A-C
Plasmid#225971PurposeRepeats-In-Toxin (RTX) protein consensus sequence GGAGADTLY repeated nine times with C-terminal Capping DomainDepositorInsertRTMCR-TLY-X2A-C
Tags6xHisExpressionBacterialAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-GTPBP2
Plasmid#140586PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA GTPBP2
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLF6.1.0-gDNA
Plasmid#132435PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertKLF6 (KLF6 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAD3.1.0-gDNA
Plasmid#112407PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SMAD3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK525
Plasmid#114691PurposesgRNA for p150's C-terminal locusDepositorInsertp150 sgRNA
Available SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper-PlexinB2
Plasmid#115175PurposeshRNA against rodent PlexinB2DepositorInsertshRNA targeting Plxnb2
UseRNAiAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFSBC39
Plasmid#44803DepositorInsertFREQ-Seq Barcode: TTTAGA
Available SinceMay 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFSBC19
Plasmid#44783DepositorInsertFREQ-Seq Barcode: GTCAGA
Available SinceMay 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFSBC23
Plasmid#44787DepositorInsertFREQ-Seq Barcode: TGGAGA
Available SinceMay 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gDM1d
Plasmid#114387PurposepPN10 with gRNA for spCRISPR-Cas9 against the 3' UTR of the DMPK gene target: TGCGAACCAACGATAGGTG PAM: GGGDepositorInsertgDM1d
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
pTRKH2
Plasmid#71312PurposeTheta replicating shuttle vector for E. coli and gram positive bacteria. High copy number in gram positives. Erythromycin resistance, recommended to use BHI agar plates for E. coli.DepositorTypeEmpty backboneUseE. coli-gram positive bacteria shuttle vectorExpressionBacterialAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEHAC1-HA-BirAonly
Plasmid#232584PurposeExpress HA-BirADepositorInsertBirA
TagsHAExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-(-2)AP-Ub
Plasmid#232582PurposeExpress Ubiquitin tagged with a modified Acceptor Peptide (AP)DepositorInsertUbiquitin
TagsAPExpressionMammalianAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJYDC1
Plasmid#162458PurposeYeast display plasmid for expression of C-terminal fusions with Aga2p yeast agglutinin. The reporter, eUnaG2 bilirubin dependent green-yellow fluorescent protein, is fused to the NterminusDepositorTypeEmpty backboneUseShuttle vector bacteria/yeastTagsHA tag, HDEL sequence, eUnaG2 fluorescent protein…Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pND003
Plasmid#200949PurposeYeast surface display destination vector for Golden Gate cloningDepositorTypeEmpty backboneUseYeast surface displayTagsAGA2, HA, and MycExpressionYeastPromoterGAL1Available SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJYDN2
Plasmid#162454PurposeYeast display plasmid intended for co-cultivation labeling by using designed ALFA-tag binding nanobody (DnbALFA) and expression of N-terminal fusions with Aga2p yeast agglutinin.DepositorTypeEmpty backboneUseShuttle vector bacteria/yeastTagsDnbALFA nanobody and Ha and mycAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only