We narrowed to 19,451 results for: cat
-
Plasmid#158249PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
874V=βTub-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159672PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertβTub-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
MSCV-PIG-METTL14-R298P
Plasmid#141119PurposeRetroviral overexpression of mutant METTL14 in mammalian cells.DepositorInsertMETTL14 (METTL14 Human)
UseRetroviralExpressionMammalianMutationSubstitution - Missense, position 298, R➞PAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046620
Plasmid#153894PurposeYeast expression plasmid for SARS-CoV-2 M (membrane)DepositorInsertSARS-CoV-2 M (membrane) (M Severe acute respiratory syndrome coronavirus 2)
ExpressionYeastMutationwtPromoterpGAL1Available sinceJune 12, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEM-PH-citrine
Plasmid#131406PurposePurpose: synthesis of mRNA encoding a membrane marker. Insert: PH domain of the human phospholipase C delta 1 (PLCD1) fused with the yellow fluorescent protein mCitrineDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPH
UseIn vitro transcriptionTagscitrine yellow fluorescent proteinPromoterT7Available sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
C1ORF43-3xFLAG
Plasmid#130880PurposeExpresses human C1ORF43 with C-terminal 3xFLAG tagDepositorAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-ACTC1-Puro
Plasmid#128326PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against mouse ACTC1 for activation (Actc1 Mouse)
ExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
FB029
Plasmid#119713PurposePromoter paf from Penicillium chrysogenum domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter paf
UseSynthetic Biology; Domestication of dna parts for…PromoterPromoter pafAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Arl6ip6
Plasmid#120235PurposeExpresses V5-tagged Arl6ip6 in lentiviral vectorDepositorAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PPHLN1 ts1
Plasmid#115877PurposePPHLN1 knockdownDepositorAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDR217
Plasmid#113872Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectivelyDepositorInsertsgRNA9-MPH2-3 sgRNA10-MAL11
UseCRISPRExpressionYeastAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10::ZF2CACTA1_3xFLAG_TET1cd
Plasmid#106433PurposepUBQ10 driven Zinc Finger human TET1 catalytic domain fusion that targets the CACTA1 promoter in arabidopsisDepositorInsertpUBQ10::ZF1CACTA1_3xFLAG_TET1cd (TET1 Human, Synthetic, Mustard Weed)
UseSynthetic BiologyTags3xFLAGExpressionPlantAvailable sinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -