We narrowed to 16,375 results for: grna
-
Plasmid#134756PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U3Ub
Plasmid#134749PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEE385
Plasmid#149289PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pG3GB411
Plasmid#134748PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN144
Plasmid#91673PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN145
Plasmid#91674PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
S8_attL1-N-term-EGFP-attL2
Plasmid#128472PurposeEGFP entry clonesDepositorInsertEGFP entry clones
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX201
Plasmid#89265PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA02DepositorInsertOsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[GFPApt]
Plasmid#68428PurposeTransient expression in mammalian cells of an "INT" construct_bearing the GFP aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the GFP aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xK-T]
Plasmid#68429PurposeTransient expression in mammalian cells of an "INT" construct_bearing three kink-turns, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing three kink-turns
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 - LRR1 Terminal CRISPR
Plasmid#221705PurposeCas9 targeting plasmid with gRNA specific for LRR1 N-terminusDepositorInsertTGTAGCTTCATCTCGCCCAA
UseCRISPRPromoterChicken Beta-actinAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-29
Plasmid#160219PurposeAtpU6-29 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-29 promoter
UseGolden gate level 0 piece to express grnasAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-87
Plasmid#163085PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5DepositorInsertVPR
TagsMCPExpressionYeastPromoterADH1Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-pleCopyCatcher
Plasmid#174061PurposeCopyCatcher insertion donor for the pale locusDepositorInsertPale (Pale Synthetic, Fly)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only