We narrowed to 11,980 results for: SOM
-
Plasmid#116276PurposeLentiviral expression of EGFR L858RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE-EGFR-E746_T751delinsA
Plasmid#116246PurposeLentiviral expression of EGFR E746_T751delinsADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR
Plasmid#116731PurposeLentiviral expression of EGFRDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EPHA2
Plasmid#116732PurposeLentiviral expression of EPHA2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GUCY2C
Plasmid#116749PurposeLentiviral expression of GUCY2CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NFE2L2
Plasmid#116765PurposeLentiviral expression of NFE2L2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/Strep-HA-ZAK beta
Plasmid#141195PurposeExpresses Strep-HA-ZAK beta in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
loxP-Hygro-loxP-HA-mStayGold-Rab11 HR
Plasmid#229678PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with monomeric StayGold and an HA epitope tag. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-Halo-ALFA-polyA-G418 HR
Plasmid#229681PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with HaloTag and an ALFA tag. Contains a G418 resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-mStayGold-polyA-Hygro HR
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-SNAP-V5-polyA-Puro HR
Plasmid#229680PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with SNAP tag and a V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
loxP-G418-loxP-3xALFA-Halo-Rab11 HR
Plasmid#229676PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with Halotag and 3x ALFA tag. Contains a G418 resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
loxP-Puro-loxP-3xV5-SNAP-Rab11 HR
Plasmid#229677PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with SNAP tag and a 3x V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MEF2D_BCL9
Plasmid#205850PurposeExpress mEGFP-tagged fusion protein, MEF2D_BCL9 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MEF2D_SS18
Plasmid#205853PurposeExpress mEGFP-tagged fusion protein, MEF2D_SS18 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only