171,784 results
-
Plasmid#60490PurposeContains a mutant version of the WT pSynSRE-T-Luc reporter plasmid. Four point mutations in the promoter SRE elements abolish SREBP-induced luciferase expression as described by Smith et al., 1988DepositorInsertHMG-CoA synthase promoter (-324/-225) fused to HMG-CoA synthase TATAA (-28/+39) transcription initiator sequence
UseLuciferaseTagsLuciferase reporterExpressionMammalianMutationFour point mutations (G->C or A->C) in the …PromoterPartial HMG-CoA synthase promoter (-324/-225) fus…Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGFP Cas
Plasmid#50729Purposemammalian expression of GFP-Cas. Note-This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP VAMP7 (1-220)
Plasmid#42316DepositorAvailable SinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
PH-PLCD1-GFP
Plasmid#51407PurposeIs a biosensor for PI(4,5)P2DepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) eGFP PPP1R8 G4
Plasmid#129021PurposeExpresses an eGFP mRNA with the PPP1R8 G-quadruplex (G4) region in the 3' UTRDepositorInserteGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGRG25
Plasmid#16665DepositorInsertmTn7::MCS
ExpressionBacterialAvailable SinceJan. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-ultraID-Puro
Plasmid#207726PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a ultraID-2A-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p3xFLAG-CMV10-hAtg13
Plasmid#22872DepositorAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac2.0
Plasmid#119872PurposeCumate-inducible expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR
sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPveg promoter with CuO sequence and PxylR promoterAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only