We narrowed to 9,883 results for: EPO
-
Plasmid#103665PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-584-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-584-5p target (MIR584 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7g-5p
Plasmid#103158PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7g-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7g-5p target (MIRLET7G Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-125a-5p
Plasmid#103188PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-125a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-125a-5p target (MIR125A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-876-3p
Plasmid#103742PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-876-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-876-3p target (MIR876 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-301a-3p
Plasmid#103396PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-301a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-301a-3p target (MIR301A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-1-3p
Plasmid#103413PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-1-3p target (MIR30C1 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Luc-Hdm4-3'UTR-F2d5
Plasmid#64018PurposeLuciferase reporter of human Hdm4 3'UTR F2 fragment mutant #5DepositorAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-25-5p
Plasmid#103376PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-25-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-25-5p target (MIR25 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-5p
Plasmid#103153PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-5p target (MIRLET7E Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-3p
Plasmid#103152PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-3p target (MIRLET7E Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_CMV
Plasmid#99313PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIS1-mutant RhoA 3'UTR
Plasmid#26090DepositorInsertmutant RhoA 3'UTR (RHOA Human)
UseLuciferaseTagsExpressionMammalianMutationBoth miR-31 binding sites in 3’ UTR mutagenized. …PromoterAvailable SinceOct. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom285bp-pGL4.10Luc
Plasmid#60873PurposeLuc reporter driven by 285 bp of the CIP2A promoterDepositorInsert285 bp promoter fragment of Cancerous Inhibitor of PP2A2 (CIP2A Human)
UseLuciferase; PromoterlessTagsExpressionMutationPromoterAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1210
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle238 (TRH Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
UseTagsExpressionBacterialMutationPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVKS-1
Plasmid#233086PurposeHNRNPD full-length promoter reporter constructDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
UseTagsExpressionMammalianMutationPromoterAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
UseTagsExpressionMammalianMutationPromoterAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaMK2rep
Plasmid#239622PurposeCaMKII activity reporter. The plasmid contains sGFP2 fluorescent protein, 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.DepositorInsertSpotNES-sGFP2-SynP3-3xmyc (Syn1 Rat, Synthetic)
UseTagsSpot, myc, and sGFP2ExpressionMammalianMutationPromoterCMVAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
nCaMK2rep
Plasmid#239624PurposeCaMKII activity reporter. The lentiviral plasmid contains a nanobody sequence (PSD95.FingR), 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.DepositorInsertPSD95.FingR-NES-SynP3-3xmyc (Syn1 Rat, Synthetic)
UseCre/Lox and LentiviralTagsFlag and mycExpressionMammalianMutationPromoterhSynAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only