We narrowed to 41,013 results for: Eras
-
Plasmid#176915Purposeexpress Paragranulin with linker 1 in mammalian cellsDepositorInsertParagranulin + linker 1 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SV40P-Tet2 enhancer H1
Plasmid#63883PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet2DepositorInsertTet2 enhancer fragment H1
UseLuciferaseExpressionMammalianPromoterSV40Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a(dual-gRNA)_h7SK(PacI-ClaI)_U6(I-SceI-NheI)_PGK-puro
Plasmid#189635PurposeLentiviral expression of double dual-AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK arrayed Cas12a gRNA cassette, hU6 arrayed Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNeuLite PEA3 mt
Plasmid#16248DepositorInsertHer-2/neu promoter (ERBB2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPEA3 mt: PEA3 motif AGGAAG changed to AGCTCGAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Paragranulin-no linker
Plasmid#176917Purposeexpress Paragranulin without linker 1 in mammalian cellsDepositorInsertParagranulin (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cDHFR174
Plasmid#188256PurposePlasmid ensures constitutive expression of the C-terminal fragment of split DHFR (aa 1-173), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJWK_VD_01
Plasmid#158102Purpose5'UTR stem-loop luciferase reporter: 0kcal/molDepositorInsert5'UTR synthetic stem-loop 0kcal/mol
UseLuciferaseExpressionMammalianPromoterPGKAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T,LacI-T]
Plasmid#60770PurposeContains PI driving expression TreR-T, and PI driving expression of LacI-T.DepositorInsertsTreR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-CIBN
Plasmid#183937PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to optogenetic CIBN domain; bound by PHR upon blue light exposureDepositorInserttdPCP-CIBN (CIB1 Mustard Weed, Synthetic)
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn S87E
Plasmid#36059DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-TbID-emerin
Plasmid#175099PurposeLentiviral expression of V5-TbID-tagged mouse EmdDepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 2-no linker
Plasmid#176921Purposeexpress Granulin 2 without linker 3 in mammalian cellsDepositorInsertGranulin 2 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 1+linker2
Plasmid#176918Purposeexpress Granulin 1 with linker 2 in mammalian cellsDepositorInsertGranulin 1+linker2 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-LPPRC-mod
Plasmid#48168Purposecontains Renilla Luciferase gene preceded by a mutated (ATG --> TTG) upstream open reading frame elementDepositorInsertLRPPRC leucine rich pentatricopeptide repeat containing (LRPPRC Human)
UseLuciferaseMutationA/T mutation in the ATG of the uORFAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
PA-RL-BAD
Plasmid#78859PurposeDULIP positive control (bait) for assay establishmentDepositorInsertBCL2 associated agonist of cell death (BAD Human)
UseExpression vectorTagsProtein A, Renilla luciferaseExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
1068 pGL3 FasL promoter (no SV40 prom)
Plasmid#9029DepositorInsertFas ligand promoter (FASLG Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationRemoved the SV40 promoter from pGL3Available SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SV40P-Tet1 enhancer E
Plasmid#63880PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet1DepositorInsertTet1 enhancer fragment E
UseLuciferaseExpressionMammalianPromoterSV40Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only