We narrowed to 12,778 results for: NUC
-
Plasmid#118317PurposeExpression of human RanDepositorTagsGFPExpressionMammalianMutationin-frame insertion of RanV19 into GFPEpac1RA2 and…Available SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-actin-G168D,Y169D
Plasmid#118384PurposeGateway compatible donor vector with actin-G168D,Y169D.DepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75235PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_R (OZ512)
Plasmid#27187DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16l (B694)
Plasmid#92030Purposeexpresses CRY2 (Full length, mutant NLS) fused to Gal4DNA (residues 1-147) fused to VP16 activation domain (long form)DepositorInsertCRY2 (CRY2 Mustard Weed)
TagsGalBD-VP16ExpressionMammalianMutationNLS sequence of CRY2 mutatedPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-OiRS3GG
Plasmid#98589PurposeExpresses default target RNA (gI intron) and pheS cassette (in place of an antisense RNA probe, for golden gate cloning) in E. coli (kanR).DepositorInsertsgroup I intron
PheS cassette to be selectively replaced by unique asRNA probes
ExpressionBacterialPromoterpBAD and pLtetOAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_L (OZ511)
Plasmid#27186DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
SDC3_L (OZ595)
Plasmid#35235DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
SDC3_R (OZ596)
Plasmid#35236DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-eNme2.C.NR-nCas9(D16A)-PolI5MΔ
Plasmid#249077PurposeExpresses nucleus-localized eNme2.C.NR-nCas9 (D16A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInserteNme2.C.NR-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-NNG-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249079PurposeExpresses nucleus-localized NNG-Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertNNG-Slug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only