We narrowed to 167,150 results for: Gene
-
Plasmid#78653PurposepSB3K3 carrying araC-PBAD-30hrpV-t-J101-32arsR-t-ParsR-30hrpR-30hrpS-t-hrpL-30gfp-tDepositorInsertaraC-PBAD-30hrpV-t-J101-32arsR-t-ParsR-
UseSynthetic BiologyPromotersee insertAvailable SinceAug. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pSCKtheoRaj12
Plasmid#69942PurposepSTC2,TheoHHAzRaj12,cisRaj12-sfGFP, kanRDepositorInsertTheoHHAzRaj12,cisRaj12,sfGFP
UseSynthetic BiologyAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj11
Plasmid#69939PurposepSTC1,TheoHHAzRaj11,cisRaj11-sfGFP, kanRDepositorInsertTheoHHAzRaj11,cisRaj11,sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCKbreak12
Plasmid#69938PurposepSTC2,cisRaj12-sfGFP, KanRDepositorInsertCisRaj12-sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj12-o11
Plasmid#69941PurposepSTC2,theoHHAzRaj12,cisRaj11-sfGFP, KanRDepositorInsertTheoHHAzRaj12,cisRaj11,sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNV-memTdTomato-2AcytoGFP
Plasmid#53124PurposeRetrovirus vector backbone that co-expresses GFP and a gene of interest fused to memTdTomato, driven by the Spleen Necrosis Virus promoter; for use in chicken cellsDepositorTypeEmpty backboneUseRetroviral; Expression in chicken cellsTags2A-cyto-GFP and memTdTomatoPromoterSNV (spleen necrosis virus)Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pGR595
Plasmid#213785PurposeIntegrates at the CAN1 locus the BadBoy2 TP-DNAP1 variant and the Nourseothricin resistance marker. Includes an I-SceI transient expression cassette.DepositorInsertBadBoy2 TP-DNAP1
UseSynthetic BiologyExpressionYeastAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC189
Plasmid#32114DepositorTypeEmpty backboneUseTransposon delivery vectorTags3x FLAGAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSpliceExpress
Plasmid#32485DepositorTypeEmpty backboneAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCSDest
Plasmid#22423DepositorTypeEmpty backboneAvailable SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDESTsplice
Plasmid#32484DepositorTypeEmpty backboneAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pZP06
Plasmid#232320PurposepZP05 was constructed by cloning the oriFn-Pfdx-E-repA fragment from pCWU6 into the smaller suicide plasmid pCM-galK, creating a conditional plasmid with replication controlled by Pfdx-E.DepositorInsertPfdx-E
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKSV7
Plasmid#26686DepositorTypeEmpty backboneAvailable SinceDec. 16, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAK405
Plasmid#37114DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2
Plasmid#22424DepositorTypeEmpty backboneUseDestination vectorAvailable SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJK647
Plasmid#71701PurposeProduces E. coli thioredoxin reductase (EcTrxB)DepositorInsertthioredoxin reductase
ExpressionBacterialPromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK645
Plasmid#71700PurposeProduces E. coli thioredoxin (EcTrxA)DepositorInsertthioredoxin
ExpressionBacterialPromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#225681PurposeConfers puromycin resistance to Salpingoeca rosettaDepositorInsertpEFL-Pac-Actin_3'UTR
Available SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HMGN1
Plasmid#192718PurposeGateway entry vector encoding human HMGN1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDTA-5
Plasmid#128845PurposeGateway-compatible p15A origin plasmid with a DTA negative selection cassette for targeting vector construction, I-CeuI, low copy numberDepositorTypeEmpty backboneUseMouse TargetingExpressionMammalianAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLfa1180fa
Plasmid#107615PurposeShuttle vector for easy cloning into Minos/3xP3 transgenesis vectorsDepositorTypeEmpty backboneAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXP420 v2 (repaired Amp promoter)
Plasmid#86920PurposeShuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoterTEF1Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJO-7
Plasmid#31992DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pZP05
Plasmid#232319PurposepZP05 was constructed by cloning the oriFn-repA fragment from pCWU6 into the smaller suicide plasmid pCM-galK, facilitating replication in Fusobacterium nucleatumDepositorInsertOri-repA
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC11
Plasmid#227588PurposeLentiviral plasmid expressing human H2BC11 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1b
Plasmid#192732PurposeGateway entry vector encoding zebrafish nrip1bDepositorInsertnrip1b (nrip1b Zebrafish)
UseGateway entry vectorMutationL661P (rs511527097); S720P; A801T; K862E; A863P; …PromoterNoneAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK561
Plasmid#72283PurposeProduces Acetobacter aceti 1023 thioredoxin with Cys35>Ser mutant (AaTrxA-C35S)DepositorInsertthioredoxin
ExpressionBacterialMutationchanges cysteine-35 to serinePromoterT7Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK523
Plasmid#72442PurposeProduces Acetobacter aceti 1023 small hypothetical protein adjacent to purEK genes, with N-terminal His6 tag (H6AaOrfX)DepositorInserthypothetical protein
TagsHis6ExpressionBacterialMutationsynthetic gene with ~40 silent substitutionsPromoterT7Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK590
Plasmid#71698PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag (AaTrxB1H6)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialPromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-49: MYL2-mEGFP
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
iMb-Notch-Mosaic (IR99.40)
Plasmid#99749PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different membrane localized fluorescent proteins and Notch signalling genesDepositorInsertMbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …Available SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGG L2 TaStb15
Plasmid#226630PurposeWheat transformation vector used to express wheat Septoria tritici blotch (Stb) resistance gene 15DepositorInsertTriticum aestivum (wheat) Septoria tritici blotch 15 (TaStb15) disease resistance gene
UseSynthetic BiologyExpressionPlantPromoterNative TaStb15Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
Plasmid#32702PurposeConditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.DepositorInserteGFP
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBBR1MCS-2
Plasmid#85168PurposeMobilisable shuttle and expression vector. Replicates in many Gram-negative bacteria. Has multiple cloning site with blue/white selection function. Cloned genes driven by derepressed lac promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneExpressionBacterialPromoterConstitutive (derepressed P-lac)Available SinceNov. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKL2299
Plasmid#186332PurposeThis plasmid carries the majority suite of Agrobacterium virulence genes from Ti plasmid pTiBo542. The additional copies of vir genes enhance Agrobacterium-mediated plant transformation.DepositorInsertvirulence genes from Agrobacterium tumefaciens pTiBo542
ExpressionBacterialAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLC-242
Plasmid#73189PurposeTemplate plasmid which encodes chloramphenicol resistance gene for positive selection and a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) for negative selection.DepositorInsertchloramphenicol (cat Although Ampicillin gene is present, it was inactivated while cloning.)
ExpressionBacterialPromoterchloramphenicol promoterAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDOC-GG
Plasmid#149377PurposeChassis plasmid for building mutagenesis cassettes by Golden Gate assembly to form a donor plasmid for recombineering by Gene DoctoringDepositorInsertsFragment containing a kanamycin resistance cassette
Fragment containing pMB1 origin of replication and an I-SceI recognition sequence
Fragment containing a lacZ⍺ expression cassette flanked by BsaI sites
Fragment containing an I-SceI recognition sequence
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
p101_CRISPRai_PiggyBac
Plasmid#213777PurposeExpresses Tet-On inducible CRISPRai orthogonal system with VPR-dSaCas9, dSpCas9-KRAB-BFP, zeocin resistance gene, and Tet-On transactivator. PiggyBac vector.DepositorInsertsVPR-dSaCas9
dSpCas9-KRAB-BFP
zeocin
Tet-On transactivator
UseCRISPRPromoterEF1a (EF-1-alpha intron a) and Tet_On_TREAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SUPV3L1-HA WT
Plasmid#232348PurposeExpresses human SUPV3L1/SUV3 in mammalian cells with HA tagDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only