We narrowed to 14,223 results for: Cas9
-
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cas9 ROSA sgRNA mCherry
Plasmid#155280PurposeLentiviral Cas9 expression, ROSA sgRNA expression, mCherry markerDepositorInsertspCas9
Available sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZS157 CRISPEY RT/Cas9
Plasmid#114454PurposeYeast Integration Plasmid for galactose inducible Ec86-RT and SpCas9 expressionDepositorInsertSpCas9, Ec86-RT
UseCRISPRTagsSV40-NLSExpressionYeastMutationS. cerevisiae codon optimizedPromoterGAL1-GAL10Available sinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiRNACRISPR_005 - hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE
Plasmid#138147PurposeExpresses RfxCas13d in mammalian cells, localized in the nucleus. For cloning of guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. F overhang aaac. R overhang aaaaDepositorInsertCasRx
UseLentiviralTagsNLSAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPomyces-2BD
Plasmid#234428PurposePlasmid for Streptomyces containing gene of modified Cas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified Cas9 with polyaspartate linking
ExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAH01Sp::Cas9
Plasmid#128160PurposePtet-controlled expression of S. pyogenes Cas9DepositorInsertSp Cas9
ExpressionBacterialPromoterPtetAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-Dual-iCas9-hALB
Plasmid#167502PurposeExpression of dual inducible Cas9 with hALB promoterDepositorInsertCas9
UseCRISPR, Lentiviral, and LuciferaseTagsFLAGExpressionMammalianPromoterhALBAvailable sinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDN-Sth1Cas9
Plasmid#221386PurposeCas9 under control of AHT inducible TetR on integrating plasmid (KanR) using L5 integrase and attP for site-specific integration into attBDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSth1 Cas9
UseCRISPRAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas serviceAAV1, AAV2, AAV5, AAV8, AAV9, and AAV RetrogradeInsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK288 (mAID-Bsr)
Plasmid#72826PurposeC-terminal tagging with mAID using CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAID-Bsr
UseCRISPRTagsmAIDExpressionMammalianAvailable sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags3xFLAG and 126aa domain from HSV-1 UL12 fused to …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-NmeCas9-NLS-3XHA-NLS
Plasmid#87448PurposeMammalian expression of wild type Nme Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNme Cas9
UseCRISPRTags3XHA, SV40 NLS, and cMyc-like NLSExpressionMammalianPromoterCMVAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPRv2 blast
Plasmid#98293PurposeVariant of lentiCRISPRv2 that confers blasticidin S resistanceDepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable sinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable sinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSHS248
Plasmid#87354PurposeS867C/N1054C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-2 FRET constructDepositorInsertCas9
TagsHis-MBPExpressionBacterialMutationC80S/C574S/S867C/N1054CPromoterT7Available sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB_tre_dCas9_VP160
Plasmid#126031PurposePiggyBac cargo vector expressing doxycycline inducible dCas9-VP160 fusionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsdCas9 fusion with VP160
Hygromycin resistance
UseCRISPR; PiggybacExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterEF1 alpha and TREAvailable sinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by