We narrowed to 6,177 results for: nls
-
Plasmid#219785PurposeUsed for generating a transgenic line for inducing NTR2.0 expression in Cre positive cells after conversionDepositorInsertmTagBFP2
Tags3x SV40 NLSAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-EGFP-NLS
Plasmid#165441PurposeExpresses nuclear EGFP from CMV promoterDepositorInsertEGFP-NLS
UseAAVTagsNLSExpressionMammalianPromoterCMVAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-NLS-Cas9-6xHis
Plasmid#62934PurposeExpression of NLS-Cas9-6xHis in bacterial cellsDepositorInsertNLS-Cas9-6xHis
Tags6xHis tag and NLSExpressionBacterialPromoterT7Available SinceMay 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
CuO-LacI-NLS–SNAPf
Plasmid#227368PurposeLentiviral expression of LacI–SNAPDepositorInsertLacI NLS SNAPf
UseLentiviralExpressionMammalianAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-inactive M3nls
Plasmid#157854PurposeTargeted m6A RNA methylation in mammalian cells, methyltransferase-inactive mutantDepositorInsertdCas13-inactive dCas13-inactive M3nls (METTL3 Cas13b is from Prevotella sp. P5-125; METTL3 is from H. sapiens)
ExpressionMammalianMutationPspCas13b Δ984-1090 H133A; METTL3 D395AAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGs-NLS-TIR1_P2A_NES-TIR1
Plasmid#117699PurposeExpression of NLS-(Os)TIR1-HA and Myc-NES-(Os)TIR1from one mRNADepositorInsertsTRANSPORT INHIBITOR RESPONSE 1
TRANSPORT INHIBITOR RESPONSE 1
TagsHA tag, Myc-NES, and NLSExpressionMammalianMutationcodon optimized for murine expressionPromoterNone, 2A peptide from porcine teschovirus-1 polyp…Available SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSII-prEF1a-mCherry-3xNLS
Plasmid#125262PurposeFluorescent reporter for cell sizeDepositorInsertmCherry-3xNLS
UseLentiviralTags3xNLSExpressionMammalianPromoterEF1aAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-XBP1 mNeonGreen NLS
Plasmid#115968PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreenDepositorInsertX-box binding protein 1 (XBP1 Synthetic, Human)
UseLentiviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MBP-2xNLS-tdTomato
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-ATF4 mScarlet NLS
Plasmid#115969PurposeER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-IDepositorInsertactivating transcription factor 4 (ATF4 Synthetic, Human)
UseLentiviralTagsHA tag, c-myc NLS, and mScarlet-IExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-MCP-3XBFPnls
Plasmid#75384PurposeMCP-3XBFPnlsDepositorInsertMCP
UseLentiviralTags3XBFPExpressionMammalianPromoterEFSAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-AausFP1
Plasmid#220595PurposeConstitutive expression of a single-cell discriminating version of AausFP1 fluorescent protein.DepositorInsertAausFP1
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-NLS-mRuby2
Plasmid#99130PurposeAn AAV genome that expresses nuclear localized mRuby2 from the mouse Dlx5/6 enhancerDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV8, and AAV9InsertNLS-mRuby2
UseAAVExpressionMammalianPromotermDLX5/6Available SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin
Plasmid#60613PurposeEncodes YFP and NLS tagged beta-actinDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NLS-actin-R62D
Plasmid#118381PurposeGateway compatible donor vector with nuclear localization signal (NLS) attached to actin-R62D.DepositorAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-NLS-miRFP670nano-miRFP670
Plasmid#216131PurposeLentiviral vector for expressing a fusion of miRFP670nano and miRFP670 localizing to the nucleus.DepositorInsertEF1a-NuclearLocalizationSignal-miRFP670nano-miRFP670-WPRE
UseLentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only