We narrowed to 8,611 results for: GAL
-
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FUS-FusionRed
Plasmid#188393PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cellsDepositorAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GCET2_p.H177Q
Plasmid#81320PurposeGateway Donor vector containing GCET2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001147665)
Plasmid#77909Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001145991)
Plasmid#77910Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001487045)
Plasmid#77911Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-Lam
Plasmid#133902PurposeNegative control when used in combination with pAWH-largeT. Expression of Gal4BD-Bait hybrid protein. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ158a-sfGFP
Plasmid#162446PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptorsDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
TagssfGFPExpressionMammalianMutationtruncation from aa52 to aa257PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai1
Plasmid#196048PurposeEncodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple (bidirectional) GasS
Plasmid#196055PurposeEncodes a G alpha subunit (GNAS2) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorInsertsUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry2-GNB1-T2A-mCherry2-GNG2-IRES-GNAI1-mEYFP(Q69K)
Plasmid#190755PurposeExpression of trimeric G protein with mCherry2 (GNB1 and GNG2) or mEYFP(Q69K) (GNAI1) tags.DepositorTagsmCherry2 and mEYFP(Q69K)ExpressionMammalianPromoterCMVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_L (OZ535)
Plasmid#27212DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_R (OZ536)
Plasmid#27213DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gaq
Plasmid#196058PurposeEncodes a G alpha subunit (GNAQ) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaoA
Plasmid#196051PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 1) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensorDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai3
Plasmid#196050PurposeEncodes a G alpha subunit (GNAl3) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only