We narrowed to 13,645 results for: sequence
-
Plasmid#138199PurposeFRET-based Epac2 activation sensor with R466A mutation in Epac2 coding sequence.DepositorInsertCerulean-Epac2(R466A)-Venus (Rapgef4 Mouse, Synthetic)
TagsCerulean and VenusExpressionMammalianMutationContains arginine-to-alanine substitution at resi…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Cerulean-Epac2(L426W)-Venus
Plasmid#138200PurposeFRET-based Epac2 activation sensor with L426W mutation in Epac2 coding sequence.DepositorInsertCerulean-Epac2(L426W)-Venus (Rapgef4 Mouse, Synthetic)
TagsCerulean and VenusExpressionMammalianMutationContains leucine-to-tryptophan substitution at re…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PKAsub-YPet-Kras
Plasmid#138206PurposeEncodes C-terminal (substrate) fragment of FRET-based bimolecular PKA activity reporter (bimAKAR); plasma membrane targeted. Use in conjunction with pcDNA3-Cerulean-FHA1-NES.DepositorInsertPKAsub-YPet-Kras
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-A'Q-mito
Plasmid#158766PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, a modified P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'Q-mito
Plasmid#158767PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, a modified P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'S-mito
Plasmid#158768PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, the P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
pLI_C-tag TNF
Plasmid#171178Purposeinducible expression of C-tag TNFDepositorInsertC-tag TNF
UseLentiviralTagsC-tag (internal)ExpressionMammalianMutationADAM cleavage site of TNF (AA73-76) was exchanged…Promotertight TRE promoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-1x
Plasmid#172281PurposeExpressing EGFP mRNA fused with 1 tandem repeat of a 50-base sequenceDepositorInsertEGFP-N1-1x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-dInPAkt
Plasmid#181834PurposeGenetically encoded single-color sensor for monitoring plasma membrane PI(3,4,5)P2 dynamics in living cells. Based on dimerization-dependent red fluorescent protein (ddRFP).DepositorInsertLyn-dInPAkt
TagsN-terminal targeting sequence from Lyn kinase, dd…ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-iCas9-neo
Plasmid#85400PurposeLentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequenceDepositorInsertFlag-iCas9-P2A-GFP
UseLentiviralTagsFlag-iCas9-P2A-GFPAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FlipCherry-T2A-GFP
Plasmid#124436PurposeExpresses FlipCherry (TEV cleavage sequence) and T2A GFP in mammalian cellsDepositorInsertFlipCherry-T2A-GFP
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSin EGFP
Plasmid#127695PurposePlasmid contains the entire replication competent Sindbis genome with the structural genome components replaced by EGFP in an MCS locus. See Resource Information section for annotated plasmid sequenceDepositorInsertEGFP
UseSynthetic BiologyAvailable SinceJuly 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV/mIba1.GFP.miR-9.T.miR-129-2-3p.T.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA
Plasmid#226475PurposeImproved microglia-targeted transgene expressionDepositorInsertsmIba1 promoter, 1.7-kb, microglia-specific promoter
target sequences for miR-9x4 & miR-129-2-3px4 *2
EGFP
UseAAVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-dPlcR
Plasmid#181832PurposeGenetically encoded single-color sensor for monitoring plasma membrane PI(4,5)P2 dynamics in living cells. Based on dimerization-dependent green fluorescent protein (ddGFP).DepositorInsertLyn-PlcR
TagsN-terminal targeting sequence from Lyn kinase, dd…ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only