8,932 results

#48672

Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 22, 2013

Academic Institutions and Nonprofits only

#10677

William Hahn

Boehm et al Mol Cell Biol. 2005 Aug . 25(15):6464-74

Nov. 3, 2005

Academic Institutions and Nonprofits only

#51695

Coexpression plasmid of QuasAr1 and CheRiff for all-optical electrophysiology

Adam Cohen

Hochbaum et al Nat Methods. 2014 Aug;11(8):825-33. doi:

April 17, 2014

Academic Institutions and Nonprofits only

#39993

Paul Modrich

Cheng et al J Biol Chem. 1984 Sep 25;259(18):11571-5

Nov. 9, 2012

Academic Institutions and Nonprofits only

#74593

an alpha-crystallin::Venus (green lens) reporter cassette flanked by FRT sites and with a single loxP site at the 3’ end was inserted in the middle of pKHR4 mcs. Genbank accession number is KU144823.

David Grunwald

Hoshijima et al Dev Cell. 2016 Mar 21;36(6):654-67. doi:

April 22, 2016

Academic Institutions and Nonprofits only

#17629

Linzhao Cheng

Zhou et al Stem Cells. 2007 Mar . 25(3):779-89.

March 27, 2008

Academic Institutions and Nonprofits only

#12309

James Thomson

Ludwig et al Nat Methods. 2006 Aug . 3(8):637-646.

Sept. 25, 2006

Academic Institutions and Nonprofits only

#22525

Eric Campeau

Jan. 22, 2010

Academic Institutions and Nonprofits only

#13838

Shinya Yamanaka

Mitsui et al Cell. 2003 May 30. 113(5):631-42.

March 16, 2007

Academic Institutions and Nonprofits only

#16419

Bert Vogelstein

Kinzler et al Nature. 1988 Mar 24. 332(6162):371-4.

March 10, 2008

Academic Institutions and Nonprofits only