We narrowed to 23,812 results for: FUS
-
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
LV-TRE-WT mouse MyoD-T2A-dsRedExpress2
Plasmid#60624PurposeExpresses WT mouse MyoD and dsRedExpress2 in response to doxycyclineDepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.2
Plasmid#88999PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
C-BLa 1.2
Plasmid#89000PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the C-terminal fragment of the split β-lactamase.DepositorInsertC-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDT386
Plasmid#174733PurposeExpresses His-tagged DT386, a truncated diphtheria toxin without a receptor-binding domain.DepositorInsertDT386
TagsHistagExpressionBacterialMutationDeleted amino acids 412-560 (the receptor binding…PromoterT5Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mMaple-OMP25
Plasmid#141151PurposePhotoconvertible fluorescent protein targeted to the outer mitochondrial membrane (OMM) in mammalian cells.DepositorInsertOMP25 (Synj2bp Rat)
TagsmMapleExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS7
Plasmid#218715PurposeExpresses N-terminally EGFP-tagged BBS7 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP3
Plasmid#160086PurposeBacterial expression of Tn5-APEX2 fusion protein with linker AEAAAKEAAAKADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP5
Plasmid#160088PurposeBacterial expression of Tn5-APEX2 fusion protein with linker GSGAGADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLGCV
Plasmid#49862PurposeExpression in Caenorhabditis elegans of the luc+ gene (Promega), fused in frame to GFP (S65C), under the sur-5 promoter (from plasmid pTG96, John Yochem and Min Han). Backbone pPD95.79 (Firelab).DepositorInsertfirefly luciferase luc+ fused to GFP (S65C)
TagsGFP (S65C)ExpressionWormPromotersur-5Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3D-BE3
Plasmid#113413PurposeExpresses hA3D-BE3 in mammalian cellsDepositorInserthA3D-BE3 (APOBEC3D Human, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-AP-Smo-YFP-DEST
Plasmid#49099PurposeExpressing AP-Smo-YFP in mammalian cells, can be used for establishing Flp-In stable cell linesDepositorAvailable SinceNov. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCyRFP1-RhoA
Plasmid#84358Purposefusion protein of RhoA, FRET donorDepositorInsertmCyRFP1-RhoA (RHOA Human, Synthetic)
TagsmCyRFP1 N terminal fusion to RhoAExpressionMammalianPromoterCMVAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-Act3.0
Plasmid#158408PurposeCRISPR-Act3.0 system containing dpcoCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Affibody HER2:243.BirA*-pET301/NT-DEST
Plasmid#174692PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-HER2 affibody ZHER2:342 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
TagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
GA-MFF
Plasmid#141160PurposeDimerization-dependent green fluorescent protein targeted to mitochondrial outer membraneDepositorAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbB8k-csg-nb112
Plasmid#171702PurposeArabinose-inducible csgBACEFG operon for curli fiber synthesis in which curli subunit CsgA has been fused to a nanobody targeting the spike protein of SARS-CoV-2 via a flexible linker.DepositorInsertcsgBACEFG, with nanobody fused to CsgA
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC-PreE2
Plasmid#52264PurposeBacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with PreScission protease cleavage site linkerDepositorAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only