We narrowed to 2,557 results for: GCG
-
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbPDS
Plasmid#231146PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-2_NbPDS
Plasmid#231145PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAPM-miR30-MOV10-ts3
Plasmid#174279PurposeMOV10 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPU-HSA-miR30-L1221
Plasmid#174221PurposeAll-in-one control rescue-control shRNA knockdown vectorDepositorInsertHSA
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_162
Plasmid#216092PurposeCas9 [Sp] CRISPRi targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_832
Plasmid#216085PurposeCas9 [Sp] knockout targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_166
Plasmid#216093PurposeCas9 [Sp] CRISPRi targeting CD55, positive controlDepositorInsertCD55 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgNT-2_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211653PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgNT-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgNT-3_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211654PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgNT-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_HEK4_1bp-insertion
Plasmid#201977PurposeExpress a pegRNA used for 1bp insertion at HEK4 siteDepositorInsertpegRNA_HEK4_1bp-insertion
ExpressionMammalianAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-FYN1-GFP_Seq_C
Plasmid#201399PurposeKnockdown of FYN tyrosine kinase. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertFYN
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
HSF2 KO
Plasmid#200208PurposegRNA for HSF2 KODepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.108
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.109
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW228-lenti-sg1-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189944PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg1-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #1
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW230-lenti-sg3-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189946PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg3-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW402-lenti-sg2-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189951PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg2-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern332
Plasmid#188483PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTagsPB_rtTA_BsmBIExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV152
Plasmid#188485PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_3-2
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
TagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only