We narrowed to 24,757 results for: Nov
-
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AKAP79-(Ci/Ce)-Epac2-camps
Plasmid#181956PurposeGenetically encoded FRET-based cAMP indicator fused to AKAP79.DepositorInsertAKAP79-(Ci/Ce)-Epac2-camps (AKAP5 Human)
TagsAKAP79, Cerulean (CFP), Citrine (YFP), and HIS ta…ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-iGluSnFR.A184V
Plasmid#106181PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-iGluSnFR.A184V
UseAAVMutationGltI: A184VPromoterhSynapsinAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-P66-ss
Plasmid#137045PurposeE. coli expression clone (T7lac promoter) for mature P66 (aa 22-618) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66949.1 (p66 Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature P66: lacks the P66 signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSNAP-CAPZ
Plasmid#69948PurposeSimultaneous expression of a His- and SNAP-tagged β1 subunit and untagged α1 subunits of chicken CapZDepositorTagsHis 6 and SNAPExpressionBacterialAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSB
Plasmid#172413PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-Puro-sgMARK1
Plasmid#138688PurposeExpresses a human MARK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Phobos_CA
Plasmid#98169Purposeslow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with blue light, inactivation max with 580 nm (accelarates closure to ms). Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos_C128A gene
TagsmCherryExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, C128A, T15…PromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-iGluSnFR.S72A
Plasmid#106182PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72APromoterhSynapsinAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMCB320-sgNC.SPA
Plasmid#169834PurposeExpresses a negative control sgRNADepositorInsertsafe harbor sgRNA
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc-ns
Plasmid#226719PurposePlasmid enabling yeast-mediated expression of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
TagsHA tagExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-iGluSnFR.S72A.mRuby3
Plasmid#106206PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72A + mRuby3 fusionPromoterCAGAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-S109A
Plasmid#33088DepositorAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
Plasmid#156431PurposeTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTGDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAC-CLEC4E
Plasmid#172412PurposeMAC-tagged gene expressionDepositorInsertC-type lectin domain family 4 member E (CLEC4E Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL452(hygro)-Sf3b1-K700K
Plasmid#90426Purposeselectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFV1/myc-His
Plasmid#127490PurposeExpresses myc-tagged NDUFV1 in mammalian cellsDepositorAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
GlycophorinC-CD4d3+4-bio
Plasmid#73096PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding GlycophorinC with rat CD4d3+4-bioDepositorInsertGlycophorin C (GYPC Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse aB crystallin 1.5kb promoter/AcGFP
Plasmid#98104PurposeMouse aB crystallin 1.5kb promoter segment driving GFP expressionDepositorInsertAlpha B-crystallin promoter 1.5 kb fragment, Mus musculus (Cryab Mouse)
UseGfp expressingTagsGFPPromoterAlpha B-crystallin 1.5 kb promoter fragment (-150…Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Basigin-isoform1-CD4d3+4-bio
Plasmid#73100PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding Basigin-isoform1 with rat CD4d3+4-bioDepositorInsertBasigin isoform 1 (BSG Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only