We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_1
Plasmid#210625PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_2
Plasmid#210622PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_1
Plasmid#210621PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_4
Plasmid#210624PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_3
Plasmid#210623PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_2
Plasmid#210626PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_3
Plasmid#210627PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_4
Plasmid#210628PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
IR76b-T2A-QF2
Plasmid#162523PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir76b geneDepositorInsertIr76b-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir76b-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GR3-T2A-QF2
Plasmid#162521PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Gr3 geneDepositorInsertGr3-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Gr3-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR8a-T2A-QF2
Plasmid#162520PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir8a geneDepositorInsertIr8a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir8a-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR25a-T2A-QF2
Plasmid#162522PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir25a geneDepositorInsertIr25a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir25a-right-HDR-arm
ExpressionInsectAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1
Plasmid#187457PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
Plasmid#179902PurposeDonor with homologous arms for Rab11a to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17B-P2A-NLuc
Plasmid#157857Purposedonor plasmid for FMR1-NlucDepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only