We narrowed to 8,495 results for: sgrna
-
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZS160
Plasmid#134238PurposeLentiviral plasmid expressing sgRNA against HJURPDepositorInsertHuman HJURP sgRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana egg cell promoterAvailable sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
UseTagsExpressionWormMutationPromoterR07E5.16 U6 promoterAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorInsertHsAGO1-sgRNA (AGO1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorInsertHsNot1-sgRNA (CNOT1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available sinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterU6Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…TagsExpressionMutationPromoterAspergillus fumigatus U3 (RNAPIII).Available sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRCA816 - pBA904 Puro-T2A-GFP ZNF296 g6 CRISPRa guide (pRCA360 backbone) 694
Plasmid#238179PurposeLentiviral CRISPR guide vector expressing a ZNF296 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertZNF296 sgRNA CRISPRa (ZNF296 Synthetic, Human)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertCD45 sgRNA CRISPRa (PTPRC Synthetic, Human)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA815 - pBA904 Puro-T2A-GFP ZNF296 g5 CRISPRa guide (pRCA360 backbone) 695
Plasmid#238178PurposeLentiviral CRISPR guide vector expressing a ZNF296 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertZNF296 sgRNA CRISPRa (ZNF296 Synthetic, Human)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasTagsExpressionMutationPromoterAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(C)
Plasmid#236042PurposeThe plasmid pQdCas12a.sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHvL1P4GA
Plasmid#112028PurposeExpresses sgRNA in barleyDepositorInsertTaU6-LacZ-sgRNA
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-1
Plasmid#74435PurposesgRNA expression vector for mouse Dedd gene targeting intron 5DepositorInsertDedd (Dedd Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorInsertDedd (Dedd Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p206-Switch-ON
Plasmid#217885PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B8
Plasmid#172849PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B8 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 1-1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p205-5'-Switch-ON
Plasmid#217884PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B9
Plasmid#172850PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B9 (Zhong et al, eLife 2021), mEGFP translational phase (2-2), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-2) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p207-Switch-ON (FRT)
Plasmid#217886PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B10
Plasmid#172851PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B10 (Zhong et al, eLife 2021), mEGFP translational phase (2-stop), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-stop) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertKLF5 sgRNA CRISPRa (KLF5 Synthetic, Human)
UseCRISPR and LentiviralTagsmTagBFP2ExpressionMutationPromoterAvailable sinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA377 - pBA904 Puro-T2A-GFP CD55 CRISPRa guide 1 (pRCA360 backbone)
Plasmid#238168PurposeLentiviral CRISPR guide vector expressing CD55 targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertCD55 sgRNA CRISPRa (CD55 Synthetic, Human)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA810 - pBA904 Puro-T2A-GFP HES7 g2 CRISPRa guide (pRCA360 backbone) 674
Plasmid#238177PurposeLentiviral CRISPR guide vector expressing a HES7 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorArticleInsertHES7 sgRNA CRISPRa (HES7 Synthetic, Human)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only