We narrowed to 25,608 results for: Nov
-
Plasmid#208047PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4ca (catalytically inactive RING mutant); to perform bioE3; selection with blasticidinDepositorInsertRNF4 (RNF4 Human)
UseLentiviralTagsBirAoptMutationCys>Ala mutations in conserved RING domainPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
CD44-isoform1-CD4d3+4-bio
Plasmid#73098PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding CD44-isoform1 with rat CD4d3+4-bioDepositorInsertCD44 antigen isoform 1 (CD44 Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag-Bcl2-Maob
Plasmid#18005DepositorInsertMitochondria-targeted Bcl-2 (BCL2 Human)
TagsFlagExpressionMammalianMutationC terminal of Bcl-2 replaced with Maob. Targets B…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 WT 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86021PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
ExpressionMammalianMutationLacks mucin-like domainPromoterCMV IEAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-flag Mst2 (KR)
Plasmid#27372DepositorAvailable SinceFeb. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Human IntS6L
Plasmid#198409PurposeExpresses FLAG-tagged human IntS6LDepositorInsertIntegrator complex subunit 6 like (INTS6L Human)
Tags3x FLAGExpressionInsectPromoterUbi-p63eAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-FLAG-AU1
Plasmid#162117PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-FLAG-AU1
UseLentiviralTagsProtC-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-HA-AU1
Plasmid#162107PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-FLAG-AU1
Plasmid#162108PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-FLAG-AU1
UseLentiviralTagsVSVg-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-FLAG
Plasmid#162112PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-ProtC-FLAG
Plasmid#162084PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-ProtC-FLAG
UseLentiviralTagsVSVg-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-HA
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-AU1
Plasmid#162091PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AKAP79-(Ci/Ce)-Epac2-camps
Plasmid#181956PurposeGenetically encoded FRET-based cAMP indicator fused to AKAP79.DepositorInsertAKAP79-(Ci/Ce)-Epac2-camps (AKAP5 Human)
TagsAKAP79, Cerulean (CFP), Citrine (YFP), and HIS ta…ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-iGluSnFR.A184V
Plasmid#106181PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-iGluSnFR.A184V
UseAAVMutationGltI: A184VPromoterhSynapsinAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-P66-ss
Plasmid#137045PurposeE. coli expression clone (T7lac promoter) for mature P66 (aa 22-618) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66949.1 (p66 Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature P66: lacks the P66 signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only