We narrowed to 27,383 results for: GFP
-
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable sinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Man1B1-GFP
Plasmid#163646PurposeExpresses GFP tagged Man1B1 in mammalian cellsDepositorAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
acta2_GFP_pA_pDestTolpA2
Plasmid#78684Purposeacta2:GFP transgenesis constructDepositorAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-Myo19
Plasmid#127612PurposeGFP-tagged Myosin-19DepositorInsertMyo19
TagseGFPExpressionMammalianAvailable sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PITPbeta-GFP
Plasmid#58274Purposemammalian expression of GFP-PITP betaDepositorAvailable sinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
NLS-LucDM-GFP
Plasmid#127796PurposeThe expressed ORF encodes nucleus location signal with GFP and destabilized mutant Luciferase.DepositorInsertdestabilized mutant (DM) Luciferase
TagsEGFP and FLAG-NLSExpressionMammalianMutationR188Q, R261Q in Firefly Luciferase insertPromoterCMVAvailable sinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hNINJ1-GFP
Plasmid#208779PurposeInducibly expresses human NINJ1 tagged with GFPDepositorAvailable sinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PEX3*-SBP-GFP
Plasmid#120174PurposeExpresses a chimera of the peroxisomal-targeting signal of PEX3, SBP tag and GFP (fluorescent tag)DepositorInsertPeroxisomal biogenesis factor 3 (PEX3 Human)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIRESh-GFPII-S-Dlk1
Plasmid#108931PurposeGFP-tagged vector expressing secreted isoform of Dlk1DepositorInsertDlk1 (Dlk1 Mouse)
TagsGFPIIExpressionMammalianMutationcontains sequences from full length Dlk1A up to t…Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable sinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-ATG9A
Plasmid#198529PurposeExpression of ATG9A-GFP fusion protein in mammalian cellsDepositorInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianMutationsilent mutations in codons 4 and 775PromoterCMVAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1
Plasmid#85664PurposeExpression of human YOD1 with N-terminal GFP tagDepositorAvailable sinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-nArgBP2
Plasmid#74514PurposeExpress GFP-nArgBP2 fusion protein in mammalian cellsDepositorAvailable sinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV asRILpolyGly GFP (OPDM type 4)
Plasmid#250411PurposeGFP-tagged polyglycine protein expressed from the antisense transcript of RILPL1. This vectors uses 100 GGN optimized codons.DepositorInsertasRILpolyGly
UseAAVTagsGFPExpressionMammalianAvailable sinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA4/TO/GFP-ZNF598
Plasmid#141191PurposeExpresses GFP-ZNF598 in mammalian cells, can be used to make inducible cell lineDepositorAvailable sinceJune 18, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pATF4-donor
Plasmid#113805PurposeCRISPR donor plasmid to tag human transcription factor ATF4 with GFPDepositorInsertATF4 homology arms flanking EGFP-IRES-Neo cassette (ATF4 Human)
UseCRISPRMutationrs140428747Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMTF1-donor
Plasmid#113829PurposeCRISPR donor plasmid to tag human transcription factor MTF1 with GFPDepositorInsertMTF1 homology arms flanking EGFP-IRES-Neo cassette (MTF1 Human)
UseCRISPRAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only