We narrowed to 13,645 results for: sequence
-
Plasmid#123820PurposeEncodes ER Targeting Sequence (N Terminal) as a Type 4a part to be used in the MTK systemDepositorInsertKDEL
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK4_006
Plasmid#123814PurposeEncodes spacer sequence (multicistronic) as a Type 4 part to be used in the MTK systemDepositorInsertSpacer for multicistronic
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK2_025
Plasmid#123717PurposeEncodes crippled human pEF1alpha as a Type 2 part to be used in the MTK systemDepositorInsertpEF1ac
ExpressionMammalianMutationCrippled Kozac sequenceAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.4
Plasmid#133526PurposesfGFP driven by a T7 promoter with the tetO sequence 7 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.1
Plasmid#133523PurposesfGFP driven by a T7 promoter with the tetO sequence 4 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR-nfatc1_sgRNA2
Plasmid#132978Purposenfatc1 sgRNA targeting to "5'-GTGGGAGCTCCATTGGATCG-3" in pDR274DepositorInsertnfatc1 sgRNA2 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA1
Plasmid#132979Purposeitga9 sgRNA targeting to "5'-GAATGACGGAGCTCTCTACG-3" in pDR274DepositorInsertitga9 sgRNA1 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA4
Plasmid#132980Purposeitga9 sgRNA targeting to "5'-TCCGCTGCCAGCCAGCCGG-3" in pDR274DepositorInsertitga9 sgRNA4 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA7
Plasmid#132981Purposeitga9 sgRNA targeting to "5'-CCCTCCAGCCTTCCATATG-3" in pDR274DepositorInsertitga9 sgRNA7 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:TBA2p
Plasmid#128429PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing the TBA2 (At1g62060) promoter sequence (1346 base pairs), for use in Three-way Gateway cloning.DepositorInsertTESTA ABUNDANT 2 (AT1G62060 Mustard Weed)
UseGateway promoter entry clonePromoterTESTA ABUNDANT 2Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q769gp160-QES.03
Plasmid#100930PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; QES mutant with enhanced binding to antibody PG16DepositorInsertHIV-1 (Q769.d22) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations A200E;F…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.01
Plasmid#100921PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.02
Plasmid#100923PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-25711gp160-QES.c02
Plasmid#111842PurposeMammalian expression plasmid for Env from the 25711 HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (25711.2) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations I181L;V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaLgp160-QES.i01.c01
Plasmid#111839PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations T49D;P1…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422gp160-QES.c03
Plasmid#111840PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422.1) Env
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; mutations V181L;V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-pro-alphaf-Btl2
Plasmid#117665PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-pro-alphaf-Btl2
ExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pT2-cryR;dusp5CE1-P1Egfp
Plasmid#90151Purposecontains dusp5 enhancer sequence, and dusp5 specific gene promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only