We narrowed to 13,645 results for: sequence
-
Plasmid#90145Purposecontains dusp5 enhancer sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pT2-cryR;dll4CE2-basEgfp
Plasmid#90144Purposecontains dll4 enhancer 2 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE1-basEgfp
Plasmid#90143Purposecontains dll4 enhancer 1 sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;lmo2CE1-basEgfp
Plasmid#90141Purposecontains lmo2 enhancer sequence and a basal promoter driving expression of eGFPDepositorAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEdll4P1gfp
Plasmid#90125PurposeGateway Mid-entry clone containing promoter sequence specific for dll4 driving expression of eGFPDepositorAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pET151-hUCH37 (ISF1)(M148D/F149D)
Plasmid#71388PurposeExpression of hUCH37 (M148D/F149D) in E.coliDepositorInserthUCH37 (ISF1) M148D/F149D (UCHL5 Human)
TagsHIS-TEV sequenceExpressionBacterialMutationchanged methionine 148 to aspartate, phenylalanin…PromoterT7Available SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRevLCav2FeS
Plasmid#60808Purposeto disrupt iron sulfur cluster in yeast Rev3DepositorInsertREV3 (REV3 Budding Yeast)
ExpressionYeastMutationcontains 647 C-terminal amino acids and 335 bp of…Available SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB4a Cterminal tail C127S, E435C
Plasmid#60405PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta4a tubulin Cterminal tail (TUBB4a) C127S, E435C for crosslinking polyglutamate peptideDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB2a Cterminal tail C127S, E435C
Plasmid#60398PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta2 tubulin Cterminal tail (TUBB2a) C127S, E435C for crosslinking polyglutamate peptideDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWPT-ACC/ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49227PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pTH394-SUP45-L34S
Plasmid#29373DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationL34S mutant gene (corresponding to the sup45-36ts…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH401-SUP45-R65C
Plasmid#29381DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationR65C mutant gene (corresponding to the sup45-3 al…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
p198 Dync1i2.F (Ex1a)
Plasmid#26448DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform F (exon 1a) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pML104
Plasmid#67638PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(WT)
Plasmid#187023PurposeExpresses EGFP tagged human 2N4R tau (WT) in mammalian cells with CMV promoterDepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only