We narrowed to 5,242 results for: U6
-
Plasmid#109349PurposeLentiviral vector to express Cpf1 from EFS promoter, as well as a Cpf1 FlipArray from U6 promoter.DepositorInsertU6-FlipArray
UseCRISPR, Cre/Lox, Lentiviral, and Synthetic Biolog…ExpressionMammalianPromoterU6Available SinceJuly 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBh_NLS_hfCas13X(Cas13X_M17YY)_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190033Purposevector for encoding a human codon-optimized High-fidelity Cas13X (hfCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13X
ExpressionMammalianMutationY672A,Y676APromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_hfCas13d(RfxCas13d_N2V8)_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190034Purposevector for encoding a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13d
ExpressionMammalianMutationA134V,A140V,A141V,A143VPromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSX6
Plasmid#90468PurposeU6 wt in pSE358 (TRP1 CEN)DepositorAvailable SinceJune 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB_sgRBBP6-68
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, human U6…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-Dual-Guide-Donor-Cas9-H2B-mCherry
Plasmid#175570PurposeDonor shuttle plasmid to enable ligation of a second U6-GuideRNA casssette into any pX458 family backbone via digestion of both plasmids with XbaI and KpnI.DepositorTypeEmpty backboneUseCRISPRMutationXbaI site added upstream of U6 promotor. G to C …Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDCC6
Plasmid#59985PurposeBi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9 and U6>sgRNA cassetteDepositorInsertsCas9
U6-2>sgRNA
UseCRISPRTags3xFLAGPromoterU6-96Ab and hsp70BbAvailable SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKS diaCas9_sgRNA
Plasmid#74923PurposeExpresses Cas9 codon optimized for Phaeodactylum tricornutum and a sgRNA driven by a U6 promoterDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPRPromoterCas9 module and sgRNA moduleAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRUSH
Plasmid#54480PurposeMouse genomic ROSA26 targeting vector, expresses EGFP, cre/lox conditional U6 promoter pgk-puroDepositorTypeEmpty backboneUseCre/Lox, Mouse Targeting, and RNAiTagsSA-EGFP-polyA, U6 promoter, loxP, and pgk-puroExpressionMammalianPromoterU6Available SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL60024
Plasmid#245672PurposeLevel 0 Golden Gate part U6-26 terminator, GCTT - CGCTDepositorInsertU6-26 terminator
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCFD3.1-w-dU6:3gRNA
Plasmid#123366PurposegRNA expression plasmid for CRISPR mutagenesis in Drosophila (with mini-white transformation marker).DepositorInsertU6:3-gRNA
UseCRISPRExpressionInsectAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3636
Plasmid#43860Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence, uses U6 promoterDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJR255
Plasmid#78549PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. CMV driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, CMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&MosU6.syn_3xP3-DsRed1-SV40 (Tandem 2_2 gRNAs)
Plasmid#243013PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.MosU6syn (synthetic mosquito U6) promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJR288
Plasmid#78550PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. Ef1a driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, EF1aAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only