We narrowed to 19,999 results for: IRE
-
Plasmid#162656PurposeExpresses ORF68 K395A/K396A in mammalian cells with an N-terminal TwinStrep tag and HRV 3C protease cleavage siteDepositorInsertORF68
TagsN-terminal 2xStrep-Tag II and HRV 3C siteExpressionMammalianMutationAmino acids K395 and K396 mutated to alaninePromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_2
Plasmid#106312PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
XE158 GFP-delta LZ-XDpr-CS2+
Plasmid#16764DepositorInsertdelta LZ-XDpr (dact1-b Frog)
UseXenopus expressionTagsgfpMutationXDpr is truncated to delete the first 129 amino a…Available SinceMarch 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Foxp2 in situ probe
Plasmid#45620DepositorInsertFoxp2 in situ probe (Foxp2 Mouse)
UseIn situMutationfragment contains bp#1709-2142 of AF339106Available SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pRRG43-sFRP1
Plasmid#99071PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea sFRP1 (secreted frizzled related protein 1)DepositorInsertsFRP1 (secreted frizzled related protein 1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pWL502-PAM
Plasmid#174382PurposePlasmids bearing protospacer sequences with functional PAM efficiently triggered CRISPR-mediated defense in cells with corresponding spacer sequence; article demonstrates use in Haloferax mediterraneiDepositorInsertPAM-spacer
UseCRISPR; Archaeal expressionExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
myc-hIFITM3-F63Q
Plasmid#104363PurposeExpresses human IFITM3-F63Q with an N-terminal myc tag in mammalian cells.DepositorInsertIFITM3 (IFITM3 Human)
TagsmycExpressionMammalianMutationmutated the following amino acid: F63QPromoterCMVAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH3409
Plasmid#179574PurposePceh-12::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans VB-MN -specific expression of miniSOG-SL2 RFPDepositorAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG5-Myr-FLAG-p110β-DM
Plasmid#55719Purposeeukaryotic expression of myristoylation tag (Myr-FLAG) p110b RBD double mutant S205D, K224ADepositorInsertp110 beta
Tagsmyristoylation tag (Myr-FLAG)ExpressionMammalianMutationS205D, K224APromoterT7Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-2
Plasmid#172739PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-2; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDGB1a2R+pNOS_Red-F_NOSt
Plasmid#170888PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Reverse orientationDepositorInsertRed-F
UseLuciferase and Synthetic BiologyExpressionPlantMutationp.S286Y Red mutantPromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-p97-RG-mycStrep
Plasmid#31840DepositorInsertp97
TagsStrep and mycExpressionBacterial and MammalianMutationR95GPromoterCMVAvailable SinceOct. 20, 2011AvailabilityAcademic Institutions and Nonprofits only