We narrowed to 15,978 results for: grna
-
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRExpressionPlantPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9i_TRP
Plasmid#141253PurposeGalactose-inducible expression of Cas9 for addressing one target; Contains guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterGAL1 (Cas9), pSNR52 (gRNA)Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PCNA
Plasmid#188686Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDB_031
Plasmid#245331PurposeCas12a CRISPRko all-in-one positive control; targets CD47, CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA097
Plasmid#245319PurposeCas12a CRISPRko positive control; targets CD46, CD47, CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #2
Plasmid#242703PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #1
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #1
Plasmid#242702PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6:2-U6:3-tevopreq1
Plasmid#190910PurposeExpression of nicking sgRNA and epegRNA under control of separate Drosophila U6:2 and U6:3 promoters. Can be used to generate transgenic flies with vermillion+ selection.DepositorInsertEmpty Backbone
UseCRISPRExpressionInsectAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK5-g5g6-K6
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only