We narrowed to 9,596 results for: Pol
-
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Hygro
Plasmid#186671PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Hygromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor_YTHDF2_KO_Puro
Plasmid#186670PurposeDonor plasmid to endogenously knock out the YTHDF2 in Hek293 cells. Puromycin and polyA sequence is inserted between two homology arms.DepositorInsertYTHDF2 KO Puromycin (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFl Strep-sumo-TEV-hAgo2 D597N
Plasmid#136236PurposeExpressing catalytically inactive human Argonaute-2 in insect cellsDepositorInserthuman Argonaute-2 (AGO2 Human)
TagsSterp SumoExpressionInsectMutationD597NPromoterpolyhedrinAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTRF/Cavin1_L (OZ513)
Plasmid#27188DepositorInsertZinc finger array targeting PTRF/Cavin1 (cavin1b Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-nsp13 (SARS-CoV-2)
Plasmid#169190PurposeBaculoviral transfer vector to express GST-nsp13 (SARS-CoV-2) in insect cellsDepositorInsertGST-nsp13 (ORF1ab SARS-CoV-2, Synthetic)
TagsGSTExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIC4B-His-TEV-TAK1-TAB1
Plasmid#154874PurposeInsect cell optimized TAK1-TAB1 construct used to solve structure and deposit PDB ID: 4O91DepositorInsertTAK1-TAB1 (TAB1 Human)
TagsLIC TEV HisExpressionInsectMutationCodon optimizedPromoterpolyhedrinAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRK2A I12_pECIA2
Plasmid#114987PurposeBait vector PRK2A I12_pECIA2 should be used with prey vector PRK2A I12_pECIA14.DepositorInsertAT2G07040 (PRK2A Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PRK2A I12_pECIA14
Plasmid#114787PurposePrey vector PRK2A I12_pECIA14 should be used with bait vector PRK2A I12_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-human GALNTL5-3xHA
Plasmid#241431PurposeThe nucleotides coding human GALNTL5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (GALNTL5 Human)
Tags3xHAExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 variant #1-3xHA
Plasmid#240645PurposeThe nucleotides coding mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (37 kDa)-3xHA
Plasmid#240646PurposeThe nucleotides coding 37 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (30 kDa)-3xHA
Plasmid#240647PurposeThe nucleotides coding 30 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Galntl5 (20 kDa)-3xHA
Plasmid#240648PurposeThe nucleotides coding 20 kDa from the C-terminus of mouse Galntl5 variant #1 and 3xHA tag sequence were inserted under the CAG promoter.DepositorInsertUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 (Galntl5 Mouse)
Tags3xHAExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only