We narrowed to 23,291 results for: ica;
-
Plasmid#78692PurposeA weak promoter drives the expression of wild type luxR, which regulates expression of LVA-tagged GFP under the control of a strong RBS.DepositorInsertBBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator
UseSynthetic BiologyAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLBPres
Plasmid#82454PurposeEncodes synthesized SLBP that is resistant to SMARTpool siRNADepositorAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEIAV-iSyn-eGFPW
Plasmid#80161PurposeExpression in mammalian cellsDepositorInserteGFP
UseLentiviralPromoteriSynAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p-PBX1
Plasmid#78145Purposebacterial expression of GST-PBX1DepositorAvailable SinceJune 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDA200
Plasmid#74248PurposepGPD1-dPSTRy(4,3)DepositorInsertpGPD1-dPSTRy(4,3)
ExpressionBacterial and YeastAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Xlim-1 (Lhx1) XH32-3
Plasmid#74135PurposeBasic cDNA clone for the Xlim-1/Lhx1 gene. In Bluescript BS KS+. To prepare RNA for Sense: BamHI/T3; for antisense: XhoI/T7DepositorInsertlhx1 (lhx1 Frog)
Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
peZinCh-1
Plasmid#24172DepositorInserteZinCh-1
ExpressionMammalianMutationCerulean and Citrine both contain mutations Y39H …PromoterCMVAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
E17TAG GFP zeo resistance
Plasmid#69118PurposeFor E17TAG GFP reporter expression in non-zeocin resistant strainsDepositorInsertE17TAG GFP
TagsHisExpressionBacterialMutationE17 to TAGAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJW4.02
Plasmid#62867PurposeBacterial expression of MBP-PGL-1DepositorInsertMBP-PGL-1
TagsMBPExpressionBacterialAvailable SinceMarch 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPK720
Plasmid#38147DepositorAvailable SinceOct. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pBS Olfactomedin1
Plasmid#19225DepositorInsertOlfactomedin 1 (OLFM1 Chicken)
ExpressionBacterialAvailable SinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
6969 pNOTAGHsp104(K620T)
Plasmid#1237DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLX304-G3BP1-Lantern
Plasmid#250918PurposeExpresses Lantern fused to G3BP1 in mammalian cells for targeting to stress granulesDepositorInsertLantern
UseLentiviralTagsV5-G3BP1ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2Psub-WPRE
Plasmid#247180PurposeGenetically encoded voltage indicator (GEVI) JEDI-2Psub in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI-2Psub
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
KIF5A-mVenus-iLID
Plasmid#240422Purpose+end oriented kinesin for optogenetic pulling experimentsDepositorAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW mCherry-P2A-PuroR
Plasmid#239567PurposeCytosolic expression of mCherryDepositorArticleInsertmCherry
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIV-IL13-IgG4hinge-PDGFR
Plasmid#240245PurposeLentiviral transfer plasmid encoding IL13 with IgG4 hinge and PDGFR TM domainDepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXJ-Myc-KLF2
Plasmid#232654Purposetransient expresses KLF2 in mammalian cellsDepositorAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only