We narrowed to 81,316 results for: myc
-
Plasmid#240737PurposeOver-express Sc mec1-S6-PreScission Protease Site-FLAG in yeast (integrated)DepositorInsertmec1-S6-P/FLAG (MEC1 Budding Yeast)
TagsS6, followed by PreScission Protease site, follow…ExpressionYeastAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1317
Plasmid#239371PurposeS.cerevisiae Sla1-SH3#1-2 (5-131) W108A (mutation preventing binding to 2nd SH3)DepositorInsertSLA1 (5-131)
TagsGSTExpressionBacterialMutationW108AAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1279
Plasmid#239375PurposeGST-Las17 (300-422) P388ADepositorInsertLas17 (amino acids 300-422)
TagsGSTExpressionBacterialMutationProline 388 to AlanineAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only