We narrowed to 43,772 results for: tra
-
Plasmid#172366PurposeGeneration of TVA-expressing stable cell lines, resistant to the antibiotic PuromycinDepositorInsertTVA + Puro
UseRetroviralExpressionMammalianPromoterCAGAvailable SinceOct. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pet-15b-microID
Plasmid#172881Purposeexpresses microID in E. coliDepositorInsertmicroID
TagsmycExpressionBacterialMutationfragment ([aa2-171]) of aquifex aeolicus BirA wit…PromoterT7Available SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
EPS15-GFP-His
Plasmid#170860PurposeMammalian expression of EPS15-GFP-His.DepositorInsertEpidermal growth factor receptor pathway substrate 15 (EPS15) (EPS15 Human)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15b-17X-PTDH
Plasmid#166786PurposePhosphite dehydrogenase for NAD(P)H regenerationDepositorInsertPhosphite dehydroenase
TagsHis6ExpressionBacterialMutationA196R, T201S, A328T, E352N, and C356D- please see…PromoterT7Available SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HiBiT-CD9
Plasmid#162592PurposeN-terminally HiBiT-tagged human CD9 under CAG promoterDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC39A10
Plasmid#132275PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC39A10 (SLC39A10 Human)
ExpressionMammalianAvailable SinceNov. 14, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMSCV-IRES-hCD2-CD14
Plasmid#133061PurposeRetroviral expression of mouse CD14DepositorAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
IZ501: pMVP/Lenti-DEST
Plasmid#121848PurposepMVP destination vector, empty Lentivirus vector backboneDepositorTypeEmpty backboneUseLentiviral; Pmvp gateway destination vectorAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIHEU-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124434PurposeExpresses FlipGFP (caspase-3 cleavage sequence) and T2A mCherry in DrosophilaDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
ExpressionInsectAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Cas9-2XNES-2ERT2-GCN4-SV40-Zeo
Plasmid#120555PurposeExpress Cas9, 2xNES, 2 tandem ERT2 and GCN4 in mammalian cellsDepositorInsertCas9, NES, ERT2 and GCN4
UseLentiviralExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV4-A
Plasmid#74975PurposeshETV4 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.5 shETV4-B
Plasmid#74976PurposeshETV4 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pE-SUMO CRYGD
Plasmid#80755PurposeExpression of human gamma D-crystallin in E. coliDepositorAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pGL4.10-VEGFprom(-1000 to -500)
Plasmid#66129PurposeLuciferase-based reporter for VEGF promoter region (-1000 to -500 bp)DepositorInsertVascular Endothelial Growth Factor -A promoter region (VEGFA Human)
UseLuciferasePromoterVEGF -500 to -1Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGZ110 (pFA6a-3FLAG-MNase-TRP1)
Plasmid#70233PurposeChEC-tagging vector encoding a 3xFLAG tag and aa 83-231 of Mnase in pFA6a-3HA-Trp1 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitope tagDepositorInsert3xFLAG tag and aa 83-231 of Mnase
UseYeast genomic targetingAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestGFP_HuB
Plasmid#65761Purposeexpresses GFP-tagged HuB in mammalian cellsDepositorAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc-AP1S3
Plasmid#58292Purposemammalian expression of AP1S3DepositorAvailable SinceAug. 1, 2014AvailabilityAcademic Institutions and Nonprofits only