We narrowed to 24,928 results for: crispr
-
Plasmid#183449PurposeCreOFF knock-in for PSD95-Halo (amino acid position: R721)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and Halo donor
UseCRISPRAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC009.106
Plasmid#171142PurposeExpression of J106 scRNA on pBBR1-KmR plasmidDepositorInsertJ106 scRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJCC_058 FnCas12a D917A
Plasmid#171667PurposeFor bacterial expression of FnCas12a D917A (RuvC-inactivating mutation) with a C-terminal sorting motif and His tagDepositorInsertFnCas12a D917A
Tags6X His and sortase A sorting motifExpressionBacterialMutationchanged aspartate 917 to alanineAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
MsCLYBL_sgRNA1
Plasmid#111294PurposeCRISPR KO murine CLYBLDepositorInsertsgRNA1 against murine CLYBL
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
Plasmid#149588Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaBS-sgRNA500
Plasmid#149615PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaBSAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAmreB
Plasmid#149594Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable sinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSDMA66
Plasmid#128355PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available sinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria2
Plasmid#124868PurposeMutagenesis of Gria2DepositorInsertGria2 (Gria2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria1
Plasmid#124867PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF713
Plasmid#121665PurposeU6-sgRNA EF1a-ProCas9-FlaviS6-P2A-PuroDepositorInsertsUseLentiviralPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
ExpressionMammalianPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE1 gRNA #3 (targets Exon 1) (MAPRE1 Human)
ExpressionMammalianPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by