We narrowed to 4,785 results for: AAT
-
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLAU gRNA (BRDN0001145192)
Plasmid#77101Purpose3rd generation lentiviral gRNA plasmid targeting human PLAUDepositorInsertPLAU (PLAU Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SLK gRNA (BRDN0001147580)
Plasmid#77067Purpose3rd generation lentiviral gRNA plasmid targeting human SLKDepositorInsertSLK (SLK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKG2 gRNA (BRDN0001146202)
Plasmid#76921Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG2DepositorInsertPRKG2 (PRKG2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK1 gRNA (BRDN0001145897)
Plasmid#76807Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK1DepositorInsertTAOK1 (TAOK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCYL3 gRNA (BRDN0001145790)
Plasmid#76794Purpose3rd generation lentiviral gRNA plasmid targeting human SCYL3DepositorInsertSCYL3 (SCYL3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MOK gRNA (BRDN0001145525)
Plasmid#75936Purpose3rd generation lentiviral gRNA plasmid targeting human MOKDepositorInsertMOK (MOK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
WEE2 gRNA (BRDN0001147038)
Plasmid#75897Purpose3rd generation lentiviral gRNA plasmid targeting human WEE2DepositorInsertWEE2 (WEE2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYLK4 gRNA (BRDN0001146621)
Plasmid#75816Purpose3rd generation lentiviral gRNA plasmid targeting human MYLK4DepositorInsertMYLK4 (MYLK4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK5 gRNA (BRDN0001144735)
Plasmid#75787Purpose3rd generation lentiviral gRNA plasmid targeting human PLK5DepositorInsertPLK5 (PLK5 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCK2 gRNA (BRDN0001146925)
Plasmid#78083Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorInsertPCK2 (PCK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
NRBP2 gRNA (BRDN0001147825)
Plasmid#76453Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorInsertNRBP2 (NRBP2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC5A4
Plasmid#132170PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC5A4 (SLC5A4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits