We narrowed to 13,988 results for: CAR
-
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
Pet28a His6-HSPB7 (zebrafish) C49S
Plasmid#110071PurposeExpress C49S mutant of Zebrafish His6-HSPB7 in bacteriaDepositorInsertHis6-HSPB7 (hspb7 Zebrafish)
TagsHis6ExpressionBacterialMutationCysteine 49 to SerinePromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP134 [pRS406-YBR139Wp-YBR139W(S219,D415,H474A)-GFP-ADH1t]
Plasmid#106469PurposeExpresses Atg42/Ybr139w(S219,D415,H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219,D415,H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219, Aspartate 415 and Histidine 4…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHISSSO6206
Plasmid#97065PurposeExpressing Sulfolobus solfataricus orf SSO6206 proteinDepositorInsertS. solfataricus orf SSO6206
TagsN-terminal TEV protease cleavable 6xHis tagMutationnonePromoterT7Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001487146)
Plasmid#77896Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001146965)
Plasmid#77897Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001147407)
Plasmid#77898Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaIrot
Plasmid#24995DepositorInsertIrx5 (Irx5 Mouse)
TagsHAExpressionMammalianMutationDeletion of Iro box (aa 314-327), 19 aa upstream …Available SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaC
Plasmid#24996DepositorInsertIrx5 (Irx5 Mouse)
TagsHAExpressionMammalianMutationDeletes everything after Hox Domain (aa 112-177).…Available SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
Pet28a His6-HSPB7 (zebrafish) C117S
Plasmid#110072PurposeExpress C117S mutant of Zebrafish His6-HSPB7 in bacteriaDepositorInsertHis6-HSPB7 (hspb7 Zebrafish)
TagsHis6ExpressionBacterialMutationCysteine 117 to SerinePromoterT7AvailabilityAcademic Institutions and Nonprofits only -
Pet28a His6-HSPB7 (zebrafish) C49S/C117S
Plasmid#110073PurposeExpress C49S/C117S double mutant of Zebrafish His6-HSPB7 in bacteriaDepositorInsertHis6-HSPB7 (hspb7 Zebrafish)
TagsHis6ExpressionBacterialMutationCysteine 49 to Serine, Cysteine 117 to SerinePromoterT7AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau
Plasmid#46904Purposeexpresses EGFP tagged Tau in mammalian cellsDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationThis WT htau construct contains human four-repeat…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-Jaws-KGC-GFP-ER2
Plasmid#65014PurposeAAV-mediated expression of Jaws under the human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV5, and AAV8InsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only