We narrowed to 10,157 results for: gnas
-
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-ALFA-His
Plasmid#171568PurposeBacterial expression of ALFA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-ALFA-His)DepositorInsertNb127D01-ALFA-His (CXCR2 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn CaBLAM
Plasmid#244227PurposeBioluminescent reporter for calcium signaling in neuronsDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD9
Plasmid#247322PurposeThis plasmid can be used to quantify CD9 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA
Plasmid#246431PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. ssRNase enhancing mutations (H243E, H269N, R270Q) included.DepositorInsertsO.gue IscB-VR4 (H243E, H269N, R270Q) with RuvC dead mutations (D60A) and delta-TID
mCherry
ωRNA
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMV and U6Available SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-NES-ZapCV2
Plasmid#222950PurposeGenetically-encoded Cytosolic Cyan-Yellow Zinc FRET sensor. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
TagsECFP (Enhanced Cyan Fluorescent Protein), Nuclear…ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…Available SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CA-FLAG
Plasmid#179134PurposeExpression vector of human protein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV GFAP CaBLAM
Plasmid#244228PurposeBioluminescent reporter for calcium signaling in astrocytesDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_pBabePuro
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Mito-Car-GECO
Plasmid#100765PurposeLentiviral tet-inducible expression of mito-targeted genetically encoded Ca2+-indicators for optical imagingDepositorInsertLenti-Mito-Car-GECO
UseLentiviralTagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationR-GECO1: E163V/I166V/V174T/M176I/F222I/A302PPromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1αAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3mts
Plasmid#195577PurposeExpresses STAT3 with mitochondrial targeting sequenceDepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsCox8 presequenceExpressionMammalianPromoterCMV enhancer and promoterAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only