We narrowed to 9,984 results for: Uty
-
Plasmid#55762PurposeAn amino-terminal YFP fragment was fused to Ggamma2. When co-expressed with a carboxyl terminal YFP or CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(1-158)-gamma-2 (GNG2 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-METTL14-R298P
Plasmid#141119PurposeRetroviral overexpression of mutant METTL14 in mammalian cells.DepositorInsertMETTL14 (METTL14 Human)
UseRetroviralExpressionMammalianMutationSubstitution - Missense, position 298, R➞PAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-WT
Plasmid#128508PurposeLentiviral constitutive expression of C20orf24 under control of its native WT 3'UTR of human C20orf24.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN3
Plasmid#125773Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN3 (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4342 TNFR1 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244178PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): TNFR1SS-3xFLAG-TNFR1ECD(dMMP)-TNFR1TMD-CTEVp(75S)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human TNFR1 SS, ECD (no MMP site) and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (TNFRSF1A Human, Synthetic)
UseSynthetic BiologyTagsTNFR1 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4341 TNFR1 NTEVp chain (deleted MMP site) in PolyTX-mNeonGreen
Plasmid#244176PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR1SS-3xFLAG-TNFR1ECD(dMMP)-TNFR1TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR1 SS and ECD (no MMP site), murine CD28 TMD, and NTEVp 75S mutant (TNFRSF1A Human, Synthetic)
UseSynthetic BiologyTagsTNFR1 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF6x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235307PurposeLentiviral expression of ComMAND open-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235303PurposeLentiviral expression of ComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235304PurposeLentiviral expression of ComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF4x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235308PurposeLentiviral expression of ComMAND closed-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235305PurposeLentiviral expression of ComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP-FMRP-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235306PurposeLentiviral expression of ComMAND base gene regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-F866Y-V5/HIS
Plasmid#236009Purposeexpression of the F866Y kinase defective mutant variant of human DDR1 that might be associated with lung AdenocarcinomaDepositorInserthuman DDR1-F866Y receptor tyrosine kinase, full length (DDR1 Human)
TagsV5/HisExpressionMammalianMutationF866Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
Plasmid#229689PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPPromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
TR01F/hFGFR3-G380R-V5
Plasmid#214908Purposefor PiggyBac mediated integration and stable expression of hFGFR3-G380R variant that is associated with AchondroplasiaDepositorInsertFGFR3 (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationG380R substitutionPromotertruncated CMV promoterAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-R272Q
Plasmid#214911Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationR272Q substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only